PCR Y qPCR PARA DETECCIÓN DE Aeromonas salmonicida Y Flavobacterium psychrophilum EN Oncorhynchus mykis

  • Juan D. Ospina-Ramirez
Palabras clave: molecular biology, diagnosis, infection, pathogen, rainbow trout

Resumen

Introducción. Entre los principales patógenos involucrados en infecciones de trucha arcoíris (Oncorhynchus mykiss) se incluyen las especies de bacterias Gram negativas como Aeromonas salmonicida y Flavobacterium psychrophilum. Estos son los agentes etiológicos de la forunculosis y de la enfermedad bacteriana de aguas frías respectivamente, que se caracterizan por la presencia de anorexia, letargia, septicemia, lesiones necróticas y hemorrágicas. Los métodos comunes de identificación de estas especies requieren largo tiempo y trabajo, y son difíciles de implementar por la variedad de perfiles bioquímicos y la ausencia de medios selectivos eficientes. La reacción en cadena de la polimerasa (PCR) y la PCR en tiempo real (qPCR) se han posicionado como importantes herramientas en la identificación de especies bacterianas por la especificidad de la reacción. Objetivo. Diseñar y evaluar protocolos de PCR y qPCR para la detección de A. salmonicida y F. psychrophilim en O. mykiss. Métodos. Se utilizaron como control las cepas registradas Flavobacterium psuchophilum ATCC®45510 y Aeromonas salmonicida ATCC®33658; y cepas control para pruebas de especificidad: Aeromonas hydrophila, A. caviae, Streptococcus agalactie, S. pneumoniea, S. mutans, S. iniae, S. pyogenes, y Edwardsiella tarda, las cuales fueron reconstituidas y cultivadas según las especificaciones para cada cepa.  Se realizó la extracción de DNA bacteriano mediante el equipo automatizado QIAcube utilizando el Kit comercial DNeasy® Blood & Tissue siguiendo el protocolo para extracción de DNA bacteriano. La concentración y pureza del DNA fue medida utilizando el espectrofotómetro NanoDrop 2000 y se verifico integridad del DNA por medio de electroforesis en gel de agarosa 1X. Cuatro secuencias de oligonucleótidos fueron sintetizadas. Para A. salmonicida fueron sintetizadas las secuencias Forward- 5'-CACACTGAGCCTGTTCCAGA-3', y Reverse- 5'-  AGTCAGCTCGCCAAACAGAT-3' a partir del gen fstB (AM712656.1) esperando un producto de 124 pb. Para F. psychrophilum Forward – 5´- AGACTCTATCGCAGCCGTTAC 3´  y Reverse - 5'-  GTCGTCGTCTGAATCCTCA 3´, a partir del gen gyrA (CAL42851.1); Esperando un producto amplificado de 175 pb. Las sondas utilizadas en la qPCR fueron marcadas con VIC y FAM como reporteros de amplificación. Las reacciones fueron llevadas a un volumen final de 25 µL conteniendo: >10 ng de DNA, 10X taq buffer, dNTPs (0,2 mM), primer forward (0,5 µM), Primer Reverse (0,5 µM), MgCl2 (2,5 mM), taq polimerasa (1,25 U). Las reacciones fueron llevadas a cabo en el termociclador C1000 Touch™ Bio-Rad con el siguiente perfil térmico: 35 ciclos a 95°C por 30 segundos, 58°C por 30 segundos, y a 72°C por 30 s. Los productos amplificados por PCR fueron separados por electroforesis en un gel de agarosa al 1,5%. Resultados. Se obtuvo una especificidad del 100% para cada par de “primers” evaluado con las cepas bacterianas de referencia. La concentración mínima de detección para ambos agentes fue en diluciones de 1:10000 tanto para PCR como para qPCR. Conclusión- Los resultados obtenidos demostraron que los protocolos diseñados y evaluados son específicos y sensibles para la detección de A. salmonicida y F. psychrophilum, convirtiéndolos en una herramienta diagnóstica de detección rápida y específica

Palabras clave: biología molecular, diagnostico, infección, patógeno, trucha arcoíris

PCR and qPCR FOR DETECTION OF Aeromonas salmonicida AND Flavobacterium psychrophilum in Oncorhynchus mykiss

Descargas

La descarga de datos todavía no está disponible.
Publicado
2016-12-06