Revista Investigación Pecuaria http://revistas.udenar.edu.co/index.php/revip <strong>Medio de divulgación científica de la Facultad de Ciencias Pecuarias.</strong> es-ES <p>La plataforma OJS para envío de manuscritos le ha solicitado que marque las casillas correspondientes a la Declaración de Derechos de Autor, autorizando a <em>Investigación Pecuaria</em> para que el artículo pueda ser publicado. El autor principal asume la responsabilidad de los coautores para tal fin. El licenciamiento (by-nc) se enmarca dentro de “Creative Commons” (<a href="http://creativecommons.org/licenses/by-nc/4.0/deed.es_ES" target="_blank">http://creativecommons.org/licenses/by-nc/4.0/deed.es_ES</a>). Se entiende que todos los documentos, tablas y figuras son originales y autorizadas por los autores respectivos para su publicación.</p> investigacionpecuaria@udenar.edu.co (Marco Antonio Imués Figueroa) revistas@udenar.edu.co (COES - UDENAR) Tue, 06 Dec 2016 20:36:03 -0500 OJS 3.1.1.4 http://blogs.law.harvard.edu/tech/rss 60 EVALUACIÓN DEL CRECIMIENTO Y SUPERVIVENCIA EN LA LARVICULTURA DEL TAMBORERO Sphoeroides rosenblatti http://revistas.udenar.edu.co/index.php/revip/article/view/2881 <p><strong>Introducción</strong>. Las técnicas de larvicultura desarrolladas para peces marinos, como el tamborero, incluyen el uso de alimentos vivos como rotíferos y artemia. Igualmente, se adicionan microalgas vivas (Técnica de agua verde), con el fin de mejorar la calidad del agua y la nutrición del zooplancton presente dentro del tanque de cría larval. No obstante, son altos los costos que representan las microalgas, y la variedad de especies genera la necesidad de seleccionar las que mejores resultados muestren en larvicultura. <strong>Objetivo.</strong> Evaluar el uso de microalgas como enriquecedores del medio de cultivo larval de <em>Sphoeroides rosenblatti</em> en términos de crecimiento, supervivencia y calidad larval. <strong>Metodología</strong>. Entre noviembre y diciembre de 2013, se llevó a cabo un ensayo de larvicultura del tamborero <em>Sphoeroides rosenblatti</em> en las instalaciones de la estación acuícola de Bahía Málaga, Perteneciente a la  AUNAP, empleando las microalgas <em>Isochrysis galbana</em> y <em>Tetraselmis suecica</em> como enriquecedores del medio de cultivo larval.  La metodología incluyó la inducción al desove de los reproductores con hormona HCG (Prymogonil®). Las larvas fueron alimentadas con dietas vivas del rotífero <em>Brachionus plicatilis</em> y <em>Artemia franciscana</em> enriquecidos, mantenidas en tanques de 1 m<sup>3</sup>, con aireación suave y fotoperiodo natural, salinidad de 25 ppt y temperatura de 26,5 °C. Se evaluó el crecimiento en longitud total y la calidad larval (prueba de hipoxia severa).  <strong>Resultados</strong>. La talla de eclosión fue de 1,8 ± 0,1 mm. El comportamiento de la longitud en cada tratamiento, durante los muestreos del ensayo, denotan un incremento paulatino, con promedio final entre 6,7 - 7,4 mm. La Tasa de crecimiento especifico y el porcentaje de supervivencia muestran promedios entre 7,46 – 8,16%  y 0,6 – 2,4%, respectivamente.  La calidad larval promedio por tratamiento oscilo entre el 20 – 40%.  El análisis de variancia de los tratamientos en términos de crecimiento en longitud total (p&gt;0,05), supervivencia (p&gt;0,05) y calidad larval (p&gt;0,05), no presentaron diferencias significativas. <strong>Conclusión</strong>. Independiente del tipo de medio enriquecedor empleado (microalgas), estadísticamente los resultados en términos de crecimiento, supervivencia y calidad larval no son significativamente diferentes entre los tratamientos. Teniendo en cuenta las mínimas diferencias observadas se sugiere trabajar con la microalga <em>Isochrysis galbana</em> como medio de enriquecimiento. Se realiza el primer reporte documentado en la costa Pacífica colombiana de la especie de tetraodontidae <em>S. rosenblatti</em>, conocida como tamborero.</p><p> <strong>Palabras claves</strong>: pez globo, cultivo, agua verde, calidad larval, longitud total</p><p align="center"><strong>EVALUATION OF GROWTH AND SURVIVAL IN LARVICULTURE OF THE TAMBORERO <em>Sphoeroides rosenblatti</em> </strong></p> Nayibe Madrid-Cortés ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2881 Tue, 06 Dec 2016 20:36:03 -0500 CRECIMIENTO DEL PEZ TAMBORERO Sphoeroides rosenblatti EN RELACIÓN A LA DENSIDAD DE SIEMBRA http://revistas.udenar.edu.co/index.php/revip/article/view/2882 <p><strong>Introducción.</strong> El <em>Sphoeroides rosenblatti </em> es una especie que se presenta en la  costa pacífica colombiana, su importancia se relaciona a que la carne de los peces de la familia Tetradontidae es de excelente gusto por su sabor y firmeza  y en países asiáticos tiene una gran demanda y un alto precio en el mercado. <strong>Objetivo. </strong>Evaluar el crecimiento de juveniles de  tamborero <em>S. rosenblatti</em> a tres densidades de siembra 0,5, 1 y 1,6  g/L en tanques. <strong>Métodos. </strong>Se utilizaron 1890 juveniles capturados del medio con  un  peso inicial de 6,11 ± 3,18 g. El diseño experimental fue completamente aleatorio con tres repeticiones y el estudio se llevó a cabo en tanques de fibra de vidrio de 1200 L, por un periodo de 63 días;  se muestreo cada 15 días el peso y longitud estándar; el alimento suministrado fue de nivel comercial que presentaba un 40% proteína bruta. <strong>Resultados. </strong>Se encontró que las  densidades de 0,5 y 1 no presentan diferencias significativas (p &gt; 0,05) en la ganancia en peso. El incremento diario máximo en peso fue de 0,21 g/día en la densidad 1,6; el mínimo fue de 0,09 g/día en las densidades 0,5 y 1 g/L. La tasa de crecimiento específico para 1 y 1,6 g/L no presentaron diferencias significativas (p &gt; 0,05). <strong>Conclusión</strong>. Se puede concluir que la densidad  que presento mejor respuesta en relación al crecimiento fue la de 1,6 g/L.</p><p><strong>Palabras claves: </strong>crecimiento,<strong> </strong>juveniles, Tetradontidae, tanque, pez</p><p><strong>GROWTH OF FISH TAMBORERO <em>Sphoeroides rosenblatti</em> ABOUT THE DENSITY OF FARMING</strong></p> Sandra L. Lamouroux-López ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2882 Tue, 06 Dec 2016 20:36:03 -0500 DESARROLLO GONADAL DEL PEZ CANCHIMALO (Ariopsis seemanni) http://revistas.udenar.edu.co/index.php/revip/article/view/2884 <p><strong>Introducción. </strong>El aprovechamiento indiscriminado del canchimalo (<em>Ariopsis seemanni</em>) en Colombia, como pez de consumo y pez ornamental sin una medida responsable, posiblemente está conllevando al colapso del recurso. <strong>Objetivo. </strong>Cuantificar preliminarmente indicadores de madurez gonadal en esta especie, con el propósito de evaluar su potencial reproductivo con fines de cultivo o manejo. <strong>Métodos. </strong>Se estudiaron los ovarios de 33 hembras adultas silvestres, las cuales fueron pesadas individualmente al igual que cada una de sus gónadas y posteriormente fue calculado el índice gonadosomático (IGS). Cada ovario fue diseccionado, se identificaron los tipos de huevos, los diámetros de los diferentes oocitos y la fecundidad relativa, considerando cantidad de huevos en estado de desarrollo cercanos al desove. <strong>Resultados. </strong>Las hembras estudiadas presentaron unos promedios en peso total y longitud total de 220,06±73,41 g y 28,42±2,55 cm respectivamente. Se identificaron cinco estadios de madurez gonadal E1, E2, E3, E4 y E5, los oocitos presentaron diámetros promedio de 2,21±0,27, 6,09±0,04, 11,53±0,74, 11,80±0,48 y 12,68±0,41 cm respectivamente. El IGS para cada estadio fue de 0,43±0,41, 2,02±0,90, 6,59±4,20, 9,83±1,47 y 9,85±2,81 respectivamente. Se estimó una fecundidad promedio de 22±3,08 huevos por hembra. El tamaño grande de huevos próximos al desove está asociado a la baja fecundidad encontrada. El IGS es un buen indicador de bienestar reproductivo, en este estudio incremento su valor en relación directa con el estadio correspondiente. <strong>Conclusión</strong>. En las gónadas se encontraron grupos de huevos con diferente tamaño y coloración, que evidencia diferencias en su crecimiento y maduración y conlleva a concluir que en la especie se presenta un desarrollo ovárico asincrónico y desoves parciales.</p><p><strong>Palabras claves: </strong>fecundidad, desarrollo ovocitario, diámetro ovocitos, índice gonadosomático</p><p> <strong>DEVELOPMENT OF FISH GONADAL CANCHIMALO (<em>Ariopsis seemanni</em>)</strong></p> Victor Hugo Espinel-Cardenas ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2884 Tue, 06 Dec 2016 20:36:03 -0500 ENSAYO DE REPRODUCCIÓN INDUCIDA EN Ariopsis seemanni. http://revistas.udenar.edu.co/index.php/revip/article/view/2885 <p><strong>Introducción.</strong> El bagre marino “canchimalo” (<em>Ariopsis seemanni</em>) es aprovechado, como pez de consumo generalmente por pobladores de la costa pacífica de Colombia; como pez ornamental (5 a 10 cm), tiene un creciente comercio a nivel nacional e internacional. Este tipo de aprovechamiento ejerce una presión pesquera, sin medidas de sostenibilidad y sin alternativas para la producción de alevinos para fines de repoblamiento o de acuicultura, lo cual representa una situación poco viable de sostenibilidad y recuperación natural del <em>stock</em> de la especie. <strong>Objetivo. </strong>Evaluar a nivel de laboratorio el efecto de dos hormonas sobre la respuesta al desove. <strong>Métodos.</strong> En la estación acuícola de Bahía Málaga de la AUNAP; se utilizaron 24 parejas (macho y hembra) de peces silvestres capturados del medio natural, en inmediaciones de la quebrada Valencia, en la zona de La Plata, en Bahía Málaga; Los reproductores fueron inducidos utilizando gonadotropina coriónica humana (HGC) y extracto pituitario de carpa (EPC). Se utilizaron cuatro tratamientos: T<sub>1</sub>: 5 mg EPC/kg peso vivo; T<sub>2</sub>: 7 mg EPC/kg peso vivo; T<sub>3</sub>: 2000 UI HGC/kg peso vivo y T<sub>4</sub>: 1000 UI HGC/kg peso vivo. <strong>Resultados.</strong> Se reconocieron macroscópicamente signos externos de madurez sexual en los reproductores, que tuvieron un peso promedio de 263,6±42,2 g. y 174,4±30,4 g. para hembras y machos, respectivamente. No se obtuvieron desoves en ninguna de las hembras inducidas transcurrido un total de 48 h. Al final del ensayo se realizó disección de las hembras de cada tratamiento. La fecundidad relativa media fue de 30,07±2,34 oocitos maduros, estimada considerando los oocitos en último estado de desarrollo. El tamaño aproximado de estos oocitos fue de 13,2±3,6 mm de diámetro. <strong>Conclusión.</strong> Aparentemente las condiciones ambientales y dosis hormonales utilizadas no fueron lo suficientemente determinantes para producir desove en las hembras inducidas: Posiblemente para nuevos ensayos, deban considerarse factores adicionales como refugios, mayores dosis, baja salinidad, como también hormona LHRH de menor costo.</p><p><strong>Palabras clave:</strong> HGC, EPC, bagre, canchimalo </p><p align="center"><strong>INDUCED REPRODUCTION TEST IN Ariopsis seemanni</strong></p> Victor Hugo Espinel-Cardenas ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2885 Tue, 06 Dec 2016 20:36:03 -0500 ETINILESTRADIOL (EE2) Y SUS EFECTOS A NIVEL HEPÁTICO Y GONADOSOMÁTICO EN Aequidens metae (Pisces: Cichlidae) http://revistas.udenar.edu.co/index.php/revip/article/view/2886 <p><strong>Introducción.</strong> En las últimas décadas, debido a los sistemas de producción, a los modelos de consumo y al crecimiento de la población, han aparecido riesgos ambientales que afectan cada vez más la biodiversidad del ecosistema acuático, donde las poblaciones se ven afectados por la exposición a sustancias xenobióticas. Dentro de estas, existen sustancias que tienen el potencial de actuar como perturbadores endocrinos alterando la fisiología de los organismos a través del antagonismo o agonismo de esteroides sexuales, constituyéndose en un riesgo, no solo para la salud general y reproductiva de los animales, sino para la salud humana. <strong>Objetivo.</strong> Evaluar el efecto de etinilestradiol (EE2) como perturbador endocrino reproductivo en adultos de <em>Aequidens metae</em>. <strong>Métodos.</strong> Se utilizaron 216 hembras y machos sexualmente maduros seleccionados con 7,5±5cm de longitud y 6,2±5g de peso, aclimatados durante 20 días y distribuidos aleatoriamente en 36 acuarios de vidrio de 20 litros, a una densidad de seis peces/acuario con recambios de agua del 20% cada tercer día. Los peces fueron expuestos a cuatro concentraciones T1=0,5, T2=5, T3=50, T4=250 ng/L de agua, grupo solvente control (etanol) y grupo control (agua) durante 21 días. Se realizó necropsia detallada en hígado y en gónadas que fueron fijados para su respectivo análisis histológico a través de H&amp;E. <strong>Resultados.</strong> Los resultados indican que a mayores concentraciones de EE2 aumentan las alteraciones histopatológicas. En hígado, los tratamientos T3 y T4, tanto en hembras como en machos causaron mayor actividad picnositaria degenerativa, activación de macrófagos, apoptosis, infiltraciones, dilatación, congestión, entre otras, comparadas con el grupo control. En los mismos tratamientos a nivel testicular, se observó acumulación de material melanomacrófago, degeneración testicular, fibrosis intersticial, atrofia y engrosamiento de la pared intersticial. En ovario, en el T1 se encontró, fibrosis intersticial, mientras que en los tratamientos T2, T3 y T4 se observó mayor congestión, fibrosis intersticial, apoptosis, atresia, material vitelogénico, etc. <strong>Conclusión.</strong> Estos resultados sugieren que <em>Aequidens metae</em> es una especie íctica sensible a los efectos de perturbación endocrina generados por EE2 con claras evidencias de alteraciones histopatológicas a nivel hepático y gonadal, lo que permite sugerirla como bioindicador para este tipo de estudios.</p><p><strong>Palabras clave:</strong> bioensayos, ecotoxicología, histología, peces, perturbación endocrina</p><p align="center"><strong>ETHINYLESTRADIOL (EE2) AND ITS EFFECTS IN LIVER AND GONADS of <em>Aequidens metae (Pisces: Cichlidae)</em></strong></p> Ana M. Pahi-Rosero ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2886 Tue, 06 Dec 2016 20:36:03 -0500 MADUREZ GONADAL DEL RÓBALO Centropomus undecimalis BAJO CONDICIONES DE CAUTIVERIO http://revistas.udenar.edu.co/index.php/revip/article/view/2887 <p><strong>Introducción. </strong>El róbalo <em>Centropomus undecimalis</em> es una especie catádroma, que permanece la mayor parte de su ciclo de vida en estuarios y migra periódicamente al medio marino para reproducirse. Se caracteriza por ser eurihalina y hermafrodita protándrica, puesto que inicialmente se desarrolla como macho y luego algunos cambian a hembras. La especie cuenta con un alto potencial para la acuicultura, ya que bajo condiciones de cautiverio presenta una rápida tasa de crecimiento y tolerancia a las oscilaciones ambientales, además de contar con un alto valor comercial. Sin embargo, el desconocimiento de las alteraciones fisiológicas y comportamentales que puede presentar el róbalo en cautiverio, impiden el desarrollo de su cultivo. <strong>Objetivo. </strong>Determinar el efecto del cautiverio en el proceso de maduración gonadal de <em>C. undecimalis</em> para lograr el cierre de su ciclo biológico. <strong>Método. </strong>En la estación experimental acuícola de Palmira, ubicada en el sector nororiental de la Ciénaga Grande de Santa Marta (CGSM), se analizaron 22 ejemplares, de los cuales se obtuvieron dos hembras y 20 machos, entre junio y octubre del 2015. El estado de madurez gonadal de cada individuo se determinó microscópicamente mediante histología convencional y se evaluaron los índices gonadosomático (<em>IGS</em>), hepatosomático (<em>IHS</em>) y factor de condición (<em>K</em>) en los machos. Periódicamente se registraron los parámetros físico-químicos del agua: temperatura, pH, oxígeno disuelto y salinidad. <strong>Resultados.</strong> En las hembras se observaron dos estados de desarrollo, cada uno con características y tamaño celular diferente: Estado I: cromatina nuclear (44,7 ± 0,5 µm) y Estado IV: vitelogénesis (223,8 ± 3,05 µm). En los machos se identificaron tres estados de desarrollo: Estado II: inmaduro, Estado III: madurando y Estado IV: maduro. Los valores del <em>IGS</em> e <em>IHS</em> no presentaron alguna relación con respecto al estado de madurez gonadal, tanto el <em>IGS </em>como el <em>IHS </em>mostraron una tendencia similar durante julio, agosto y septiembre; con los valores más bajos en agosto, mientras que en el mes de octubre presentaron una relación inversa. No obstante, los valores de <em>K</em> fueron consistentes con las fechas en las que se observó el mayor número de ejemplares maduros (estado IV). <strong>Conclusión.</strong> De acuerdo con los resultados, se puede concluir que el cautiverio, junto con el comportamiento de las variables físico-químicas del agua, no afectaron a la madurez gonadal o al cambio de sexo de <em>Centropomus undecimalis</em>. La información obtenida en el presente estudio, permite ampliar el conocimiento sobre la fisiología reproductiva del róbalo bajo condiciones de cautiverio, con el fin de fomentar el cultivo de la especie en el país.</p><p><strong>Palabras claves: </strong>acuicultura, histología gonadal, estados de desarrollo, madurez gonadal.</p><p align="center"><strong>GONADAL MATURITY OF COMMON SNOOK <em>Centropomus undecimalis </em>UNDER CAPTIVITY CONDITIONS</strong></p> Brayan Enrique Roca-Lanao ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2887 Tue, 06 Dec 2016 20:36:03 -0500 DESOVE INDUCIDO DE PIANGUA Anadara tuberculosa, CON PERÓXIDO DE HIDRÓGENO http://revistas.udenar.edu.co/index.php/revip/article/view/2888 <p><strong>Introducción. </strong>La piangua <em>Anadara</em> <em>tuberculosa</em>, es el molusco bivalvo de mayor importancia en la alimentación y economía de familias en la costa pacífica de Colombia. Este recurso es obtenido directamente del ambiente; siendo una actividad totalmente extractiva y no hay producción en cautiverio. Ya existen diagnósticos de sobreexplotación del recurso y deterioro del manglar donde son capturados. La acuicultura de la piangua sería una excelente opción y alternativa de producción agrícola para el desarrollo y subsistencia local. Además, sería una actividad sostenible que favorecería la protección y conservación de las zonas de manglar. El desarrollo y éxito de la acuicultura depende de la inducción artificial de la reproducción, ya que es una técnica necesaria para la producción segura de semilla. Los reproductores maduros de moluscos bivalvos son inducidos a la puesta utilizando métodos físicos, biológicos, químicos o combinados. Dentro de estos métodos, la adición de peróxido de hidrógeno o agua oxigenada (H<sub>2</sub>O<sub>2</sub>) en el agua, se ha destacado como la más eficaz, pero aun teniendo tanto auge, ha sido difícil estandarizar esta técnica. <strong>Objetivo</strong>. Establecer una metodología práctica para la producción de semilla de la piangua, con la adición al agua de H<sub>2</sub>O<sub>2</sub>. <strong>Métodos. </strong>Se utilizaron ejemplares con tallas entre 45 y 58 mm de longitud, recogidos en los manglares aledaños a Buenaventura, Colombia. En el diseño experimental se escogieron al azar 30 pianguas y se pusieron individualmente en recipientes plásticos. Escogiendo cinco pianguas por grupo al azar; para un total de seis tratamientos, incluyendo un control que no recibió ningún tipo de manipulación. Como referencia y base para calcular la concentración molar de H<sub>2</sub>O<sub>2</sub> en cada tratamiento se utilizó una solución en agua al 30%. La cantidad de H<sub>2</sub>O<sub>2</sub> calculada para cada tratamiento, se diluyó en aproximadamente 250 ml de agua con baja salinidad (10 unidades prácticas de salinidad, ups) y temperatura de 25 °C, en que estaban sumergidas las pianguas. Luego de tres horas de inmersión en las diferentes soluciones de H<sub>2</sub>O<sub>2</sub> se hizo recambio total de agua a una de solo salobre (10 ups); dado por terminado el periodo de prueba después de cuatro horas. Durante el periodo de prueba se hicieron observaciones continuas para detectar la expulsión de los gametos. Se diseccionaron los ejemplares que no desovaron para establecer el estado de maduración sexual. <strong>Resultados.</strong> Se observó desove de pianguas en la mayoría de las dosis, excepto en aquellas que recibieron las dosis más bajas y altas. Las pianguas que no desovaron fueron aquellas que no estaban sexualmente maduras. <strong>Conclusión.</strong> Es posible inducir la puesta en piangua con la adición de H<sub>2</sub>O<sub>2</sub> al agua. Este método es barato y simple de aplicar. Además serviría de guía para inducir la puesta de otras especies de moluscos en el país.</p><p><strong>Palabras clave:</strong> Colombia, acuicultura, reproducción inducida, agua oxigenada</p><p align="center"><strong>INDUCED SPAWNING OF PUSTULOSE ARK <em>Anadara</em> <em>tuberculosa</em>, USING HYDROGEN PEROXIDE</strong></p> Lury N. García-Núñez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2888 Tue, 06 Dec 2016 20:36:03 -0500 FERTILIZANTE COMERCIAL COMO MEDIO DE CULTIVO PARA CLORÓFITAS (Desmodesmus opoliensis) Y SU AFECTACIÓN EN LA CINÉTICA CELULAR http://revistas.udenar.edu.co/index.php/revip/article/view/2889 <p><strong>Introducción.</strong> Las microalgas son microorganismos fotosintéticos caracterizados por la producción de vitaminas, carbohidratos, carotenoides, pigmentos y lípidos. La producción de estos componentes son afectados por parámetros de cultivo como la luminosidad, disponibilidad de nutrientes entre muchos otros. Los medios de cultivo, los cuales aportan micro y macronutrientes para especies autótrofas como la familia de las <em>chlorófitas</em>, son demasiado costosos e impactan hasta en un 70% del valor comercial de un producto terminado a base de estos microorganismos, por lo que la mirada del mundo está en el uso hacia el uso de productos de forma sustentable, para hacer viables los proyectos a escala industrial de las microalgas. <strong>Objetivo.</strong> Evaluar el fertilizante edáfico comercial Remital como medio de cultivo para microalgas y su participación en el crecimiento celular. <strong>Métodos.</strong> En el Instituto de Acuicultura (IALL) de la Universidad de los Llanos (Villavicencio, Meta), se aisló una cepa de microalga <em>chlorófita (Desmodesmus opoliensis) </em>y se dejó un cultivo stock (inóculo), el cual se cultivó en medio Fertilizante Remital (Empresa Abocol) en diferentes dosis (0,5 hasta 2,0 g de remital por litro de medio) para determinar la curva cinética y su comportamiento con dos variables de respuesta: densidad celular y clorofilas totales. La densidad celular se llevó a cabo por medio de conteo celular en cámara de neubauer (cel/mL) y las clorofilas totales por espectrofotometría (µg de pigmentos/mL)<strong>. </strong>Las condiciones de cultivo fueron controladas (25ºC y un fotoperiodo de 12-12 Luz-oscuridad) durante 14 días<strong>. Resultados.</strong> La especie que se analizó presentó muy buen comportamiento de crecimiento, las curvas de crecimiento celular presentaron datos normales, homocedásticos y no presentaron diferencias significativas en sus medias (p &gt; 0,05). La microalga alcanzó una densidad celular máxima de 3,20x10<sup>6</sup> y una mínima de 9,50x10<sup>6</sup> células/mL. Por otro lado, las producciones de clorofilas totales se mantuvieron en un rango de 5,49-17,40 µg/mL.  <strong>Conclusión.</strong> Proponer un uso y escalamiento industrial de microalgas si es posible si se encuentran medios de cultivos tan económicos y eficientes como el Remital. Las dosis no representan significativamente una diferencia, sin embargo, se elige la dosis de 2g/mL de cultivo por presentar la mayor concentración celular y para garantizar que siempre exista nutrientes disponibles. Con esto, se sigue cerrando la brecha que existe entre la producción de microalgas a escala de laboratorio y a escala industrial.</p><p><strong>Palabras clave:</strong> Microalga, Clorofila, Macronutriente, escalamiento industrial</p><p><strong>COMMERCIAL FERTILIZER AS CULTURE MEDIUM FOR THEIR INVOLVEMENT IN CHLOROPHITIC </strong><strong>(<em>Desmodesmus opoliensis</em>) </strong><strong>AND CELL KINETICS</strong></p><pre> </pre> Cristian Alejandro Burgos-Rada ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2889 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE LA ACLIMATACIÓN AL CAUTIVERIO SOBRE LA CALIDAD ESPERMÁTICA DEL RÓBALO (Centropomus undecimalis). http://revistas.udenar.edu.co/index.php/revip/article/view/2890 <p><strong>Introducción.</strong> El róbalo (<em>Centropomus undecimalis</em>) es una especie eurihalina que migra de sistemas continentales al mar. Su estado de conservación es “vulnerable” debido a la falta de control de la actividad pesquera, la carencia de normas de protección de los stocks naturales y el deterioro de su hábitat. Por lo tanto, se hace necesario generar conocimiento que sirva para fomentar el establecimiento del cultivo del róbalo en el país, ofreciendo así, alternativas socioeconómicas y el mejoramiento del nivel de conservación de la especie. <strong>Objetivo. </strong>Evaluar el posible efecto de la aclimatación al cautiverio sobre la calidad espermática de reproductores del róbalo <em>Centropomus undecimalis,</em> con el fin de fomentar el conocimiento sobre su cultivo en el país. <strong>Métodos. </strong>Este trabajo se desarrolló en dos localidades: a) estación de cultivo de peces ubicada en Palmira, sector de la Ciénaga Grande de Santa Marta (CGSM), y b) laboratorio de Maricultura del Centro de Desarrollo Pesquero y Acuícola de Taganga (CDPA) de la Universidad del Magdalena. Mensualmente y durante seis meses (abril – septiembre de 2015), se tomaron al azar cinco individuos tanto de la CGSM como del CDPA (n=5) para la caracterización seminal, determinando: volumen, viabilidad, malformaciones espermáticas, además el efecto de la salinidad sobre la movilidad y tiempo de activación de los espermatozoides. <strong>Resultados. </strong>El volumen espermático no presentó diferencias significativas entre la CGSM y CDPA, siendo este de 0,23±0,16 y 0,23±0,16 ml, respectivamente (P = 0,0936). El promedio de viabilidad espermática fue de 58% para la CGSM y de 77% en el CDPA (P=0,0001). En el estudio morfológico se encontraron diferencias significativas en la incidencia de malformaciones Tipo I (no afectan significativamente la fertilidad) y Tipo II (si afectan significativamente la fertilidad), con un promedio de 0,682 ± 0,026% para la CGSM y 0,753 ± 0,022% en el CDPA (P = 0,0022). Con respecto a las muestras expuestas a 0, 10, 15, 20, 25 ppm de salinidad, no se observó ningún efecto sobre la movilidad y tiempo de activación de las células espermáticas, caso contrario con las salinidades de 30, 35 y 40 ppm, encontrando que bajo la condición de activación de 40 ppm se registraron los mejores resultados (36,99±5,46 s y 56±3,8% movilidad) respectivamente para CGSM y (60,22±4,79 s y 70±3,3% movilidad) respectivamente para CDPA; p&lt;0,05 en todos los casos. <strong>Conclusión. </strong>Bajo las condiciones de cautiverio establecidas en el presente estudio, el róbalo puede madurar y mantener una calidad espermática aceptable, tanto en condiciones estuarinas (CGSM) como marinas (CDPA). Para el caso de la activación espermática, la salinidad (35–40 ppm) influyó positivamente en la calidad del esperma de los reproductores, pues se evidenció una reducción de las malformaciones, un incremento de la sobrevivencia y una mayor movilidad de las células espermáticas en este ambiente.</p><p><strong> </strong><strong>Palabras claves:</strong> espermatozoides, calidad espermática, robalo, salinidad</p><p align="center"><strong>EFFECT OF ACCLIMATION TO CAPTIVITY ON SNOOK (<em>Centropomus undecimalis</em>) SPERM QUALITY.</strong></p> Sara Elisa Cruz-Botto ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2890 Tue, 06 Dec 2016 20:36:03 -0500 CRIOCONSERVACIÓN DE SEMEN DE SABALETA Brycon henni MEDIANTE TRES CURVAS DE CONGELACIÓN PROGRAMABLE (Pisces: Characidae) http://revistas.udenar.edu.co/index.php/revip/article/view/2891 <p><strong>Introducción. </strong><em>Brycon henni</em>, comúnmente conocida como sabaleta, es una de las especies migratorias más importantes de los pequeños ríos que tienen su origen en la cordillera central de Colombia y atraviesan las zonas cafeteras del país. La congelación de células germinales de especies piscícolas, permite generar bancos de germoplasma útiles para los programas de reproducción, en periodos de escases de ovas y semen. En Colombia, los estudios de crioconservación de semen de peces nativos son recientes y se han orientado principalmente a la estandarización de protocolos de congelación, evaluación de crioprotectores y diluyentes para disminuir los efectos tóxicos y el criodaño sobre la célula espermática. <strong>Objetivo. </strong>Evaluar la crioconservación de semen de sabaleta <em>Brycon henni</em>, mediante tres curvas de congelación programable con dos crioprotectores permeables. <strong>Metodos.</strong> El semen de 30 machos de sabaleta se diluyó en un medio suplementado con etilenglicol (EG) o dimetilsulfoxido (DMSO) y se crioconservó en pajillas de 0,5ml, mediante las curvas de congelación programable: lenta (66 min, -0,42 ºC/min), media (43,3 min, -0,6 ºC/min) y rápida (7,7 min, -5,19 ºC/min). Después de un mes de almacenamiento, el semen se descongeló y se evaluó la movilidad, mediante el Sistema de análisis de clase (SCA<sup>®</sup>) y la  viabilidad espermática (VE) mediante microscopia de fluorescencia con las sondas SYBR14 / IP. Para el análisis estadístico se ajustaron modelos lineales generalizados (GLM) y las medias se compararon por la prueba de Tukey. <strong>Resultados.</strong> Se encontró que las curvas de velocidad media y rápida presentaron valores superiores y equivalentes para la movilidad total, la movilidad progresiva y la velocidad lineal de los espermatozoides (p≤ 0,05). Mientras para la viabilidad espermática se observó superioridad para la curva de velocidad media (52,4 ± 8,6%), respecto a las curvas rápida (43,0 ± 19,4%) y lenta (29,0 ± 11,8%) (p≤ 0,05). Entre los crioprotectores utilizados sólo se encontró diferencia a favor del EG para la viabilidad espermática (p≤ 0,05). <strong>Conclusión. </strong>La congelación de semen de sabaleta (<em>Brycon henni</em>) mediante una curva de congelación programable de velocidad media, permite resultados superiores de calidad seminal post-descongelación.</p><p> <strong>Palabras Clave: </strong>Congelación de semen, crioprotector, calidad seminal, espermatozoide</p><p align="center"><strong>SEMEN CRYOCONSERVATION OF SABALETA <em>Brycon henni</em> BY THREE CURVES OF PROGRAMMABLE FREEZING<em> </em>(Pisces: Characidae)</strong></p> Juan David Montoya-Páez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2891 Tue, 06 Dec 2016 20:36:03 -0500 DESCRIPCIÓN MORFOLÓGICA DEL TESTÍCULO DE LA CUCHA MARIPOSA Pterygoplichthys gibbiceps. http://revistas.udenar.edu.co/index.php/revip/article/view/2892 <p><strong>Introducción. </strong>La cucha mariposa es un loricarido nativo que habita la cuenca de los ríos Orinoco y Amazonas. Según datos del INCODER, las cuchas son el tercer grupo de peces ornamentales de mayor exportación en Colombia, los cuales provienen en su totalidad de la extracción del medio natural, lo que puede afectar la biodiversidad del ecosistema, en este sentido es relevante conocer aspectos de la reproducción de la especie. <strong>Objetivo. </strong>Contribuir al conocimiento básico de la biología reproductiva de la Cucha Mariposa, mediante la descripción anatómica e histológica del testículo.<strong> Métodos. </strong>Se usó un macho adulto adaptado a condiciones de cautiverio en la Estación Piscícola de la Universidad de los Llanos, dos semanas después de realizar espermiación inducida en el mes de mayo (época de maduración reproductiva natural), se registró el peso corporal (g), longitud total (cm), se sacrificó con corte medular, se realizó disección mediante un corte ventral para lograr la descripción anatómica del testículo <em>in situ. </em>Se extrajo la gónada, tomaron los datos de peso y medida, se fijó en formalina buferada al 9%. Para realizar la descripción histológica se analizaron cortes longitudinales de testículo y papila urogenital, cortes transversales del conducto, porción cefálica y porción caudal del testículo sometidos a tinción con hematoxilina – eosina.<strong> Resultados.</strong> El ejemplar pesó 390.1 g con longitud total de 36.4 cm.<strong> </strong>Se encontró que los testículos de la cucha mariposa se encuentran ubicados en la cavidad celómica, ventrales con respecto al riñón y a la vejiga gaseosa, adheridos a esta última por medio de un tejido translucido y resistente, son relativamente pequeños, con un índice gonado-somático de 0,41% y 3,6 cm de longitud, los testículos de este ejemplar, son pareados desiguales (el izquierdo de mayor tamaño que el derecho), con forma ovalada irregular y una superficie puntiforme corrugada,  cada uno se une a un conducto que avanza independiente para posteriormente unirse en un solo conducto hacia caudal, que confluye  en la papila urogenital. Microscópicamente, se pudo observar un testículo espermatogonial irrestricto, con actividad espermatogénica desde la porción craneal, hasta la unión con el conducto. La pared de los túbulos seminíferos, está formada por tejido conectivo recubierto por un epitelio simple y con cistos que contenían células espermáticas en el mismo estadio. El conducto deferente está formado por una capa de musculo liso abundante, y un epitelio cubico estratificado. <strong>Conclusión. </strong>Los testículos de la cucha mariposa, son pareados, asimetricos, con mayor tamaño del testículo izquierdo y con maduración espermática en cistos, se encontraron espermatozoides en a luz de los túbulos, por lo que se infiere que los testículos se encontraban maduros y en epoca reproductiva.</p><p><strong>Palabras Clave</strong>: Loricarido, tracto reproductivo, desarrollo gonadal</p><p align="center"><strong>MORPHOLOGICAL DESCRIPTION OF THE LEOPARD PLECO TESTICLE </strong><strong>Pterygoplichthys</strong><strong> gibbiceps.</strong></p> Nilson A. Páez-Quimbaya ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2892 Tue, 06 Dec 2016 20:36:03 -0500 GONADOTROPINAS EN SILURIFORMES SURAMERICANOS Y SUS RELACIONES FILOGENÉTICAS http://revistas.udenar.edu.co/index.php/revip/article/view/2894 <p><strong>Introducción-</strong> La ictiofauna continental de Colombia reporta 1435 especies, entre ellos el orden Siluriformes, con 524 especies (12 familias), entre ellas <em>Pimelodidae</em> y <em>Heptateridae</em>. La información recopilada sobre estas especies, es principalmente sobre su distribución y ecología reproductiva, pero poco se ha documentado sobre aspectos básicos de la endocrinología y estructura genómica de hormonas de interés reproductivo. Las gonadotropinas son heterodimeros conformados por dos subunidades, la subunidad α común para todas las glicoproteínas, y una subunidad β, la cual determina la actividad biológica y especificidad. Hasta la fecha han sido reportadas las secuencias génicas para 56 especies (14 ordenes). Para especies ícticas tropicales del nuevo mundo, la información recopilada en este aspecto, es limitada o poco documentada. <strong>Objetivo -</strong> Clonar y determinar la secuencias cDNA de las subunidades α y β de la gonadotropina luteinizante (LH) de cuatro Siluriformes suramericanos, y realizar comparaciones para determinar relaciones filogenética. <strong>Métodos – </strong>Se obtuvieron hipófisis de los especímenes, para realizar la extracción de RNA y síntesis de cDNA. Las condiciones de  PCR fueron MgSO<sub>4</sub> 2 mM, dNTP’s 0.2 mM, Primers 0.5 uM (específicos subunidad), <em>Pfu</em> DNA 2.5U, el perfil térmico fue 94°C x 2 min, 94°C x 1 min, 48 - 60°C  x 30seg y  72°C x 40 seg (35 ciclos) y 70°C x 5 min  (extensión final). Los productos de PCR fueron clonados en el vector pJET1.2/blunt, y verificados por PCR y secuenciados por Macrogen I<em>nc</em>. Posteriormente, se realizó un alineamiento BLAST con las secuencias de las bases datos (NCBI, EMBL, SwissPro) y analizados con el Software MEGA4 v4.0. <strong>Resultados – </strong>La subunidad α de las especies <em>S. lima, P. grosskopfii</em> y <em>P. blochii</em>, tienen una longitud del ORF de 351pb, codón de inicio ATG y codón de parada TAA, conservados para las especies. La homología de secuencias de nucleótidos fue superior 96.01% y de la predicción de aminoácidos del 100%. En las secuencias de la subunidad β, entre, las especies <em>S. lima, P. grosskopfii</em> y <em>P. blochii, </em>se determinó una longitud del ORF de 420pb. Sin embargo, <em>R. quelen</em>  fue de 423 pb. Los codones de inicio ATG y de parada TGA,  fueron conservados entre las especies analizadas, la homología de secuencias de nucleótidos estuvo entre 83.57% y 99.05% y de la predicción de aminoácidos entre 85.51% y 99.28%. <strong>Conclusiones –</strong>  Las secuencias de nucleótidos de la subunidad β presenta mayor variación aun entre  familias del orden,  comparativamente con la subunidad α. Se puede evidenciar el distanciamiento entre las familias Heptateridae y Pimelodidae, comparativamente se identifica menor homología (48.12 y  51.26%) con las familias de distribución geográfica en Asia (Hemigabrus) y Norte américa (Ictalurus) y mayor similitud  (83.57 y 87.29%) con la familia de Africa (Clarias).</p><p><strong>Palabras claves: </strong>glicoproteínas, gonadotropinas,<strong> </strong>siluriformes, clonación</p><p align="center"><strong>GONADOTROPINS IN SOUTH AMERICAN CATFISH AND  THEIR PHYLOGENETIC RELATIONSHIPS</strong></p> Maria Fernanda Flórez-Gonzalez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2894 Tue, 06 Dec 2016 20:36:03 -0500 CONTROL ULTRASONOGRAFÍCO DE MADURACIÓN OVÁRICA DE TRUCHA ARCOIRIS (Oncorhynchus mykiss), INDUCIDA POR PITUITARIA DE TILAPIA http://revistas.udenar.edu.co/index.php/revip/article/view/2896 <p><strong>Introducción. </strong>El control de la reproducción en períodos de maduración gonadal en trucha arcoiris (<em>Oncorhynchus mykiss</em>) es fundamental para la estabilidad productiva de piscifactorías del alto andino ecuatoriano; para este propósito se utiliza GnRH análoga de salmón; sin embargo, por costos y disponibilidad del producto en el mercado ecuatoriano, este tratamiento se hace difícil para piscicultores a mediana y pequeña escala. El uso de extractos de pituitaria de tilapia en estudios <em>in vitro,</em> demuestran su viabilidad en especies como la trucha arcoíris. Por otro lado, el uso de ultrasonografía en peces, surge como una herramienta efectiva en el monitoreo de los estados gonadales, asegurando la viabilidad del reproductor y del proceso reproductivo como tal. <strong>Objetivo. </strong>Evaluar el crecimiento ovárico de trucha arcoíris (<em>Oncorhynchus mykiss</em>) bajo la acción de 3 inductores hormonales (GnRH de salmón, pituitaria de tilapia y carpa), y su valoración mediante ultrasonografía.<strong> Métodos. </strong>En el Centro de Investigaciones Acuícolas de Papallacta (CENIAC), perteneciente a la Subsecretaría de Acuacultura del Ecuador, de la población local de reproductores y previa valoración del estado gonadal (estadio III) se recolectaron aleatoriamente 24 hembras, divididas en 4 grupos. Posteriormente, se inoculó GnRH análoga de salmón, pituitarias de carpa y tilapia a dosis iguales de 0,5 mg/kg de peso vivo, y un control con suero fisiológico al 0,9%. El crecimiento ovárico fue evaluado mediante ultrasonido cada diez días, en donde las biometrías fueron analizadas con el software libre IMAGE-J. Adicionalmente, se determinó las concentraciones circulantes de 17 β estradiol con la técnica de ELISA, permitiendo relacionar el perfil esteroidogénico de cada individuo. <strong>Resultados</strong>. Las reproductoras presentaron mejores resultados con el tratamiento de GnRH análogo de salmón, con un promedio de desove entre 15 a 30 días y concentraciones de estradiol en promedio de 2,85 mg/mL, seguido del tratamiento de pituitaria de tilapia, en donde no se detectaron diferencias significativas entre tratamientos (p&gt;0,05). Por otro lado, las ovas post desove y de mayor tamaño, corresponden al tratamiento de pituitaria de tilapia, sin diferencias estadísticas con el control (p&gt;0,05). Es importante recalcar que el crecimiento ovárico tuvo un comportamiento similar en todos los tratamientos, tanto en su desarrollo longitudinal como ancho transversal. <strong>Conclusión: </strong>El uso de inductores hormonales como la pituitaria de tilapia, es una alternativa a la GnRH análoga de salmón por efecto y precio, durante la maduración final en trucha arcoíris. Cabe destacar que la valoración por ultrasonografía permite validar estadios de madurez gonadal, así como su control periódico durante el ciclo de reproducción.</p><p><strong>Palabras clave: </strong><em>Oncorhynchus mykiss, </em>Pituitaria de tilapia, ultrasonido, maduración gonadal</p><p align="center"><strong>ULTRASONOGRAPHIC CONTROL OF OVARIAN MATURATION OF RAINBOW TROUT (<em>Oncorhynchus mykiss</em>), INDUCED BY TILAPIA PITUITARY</strong></p> Margarita Rivera ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2896 Tue, 06 Dec 2016 20:36:03 -0500 APORTES AL CONOCIMIENTO DE LA REPRODUCCIÓN EN CAUTIVERIO DEL PEZ OSCAR (Astronotus ocellatus) http://revistas.udenar.edu.co/index.php/revip/article/view/2898 <p><strong>Introducción. </strong>El pez Oscar <em>Astronotus ocellatus</em> es un cíclido nativo, con importancia económica en el departamento del Vichada, tanto la calidad de la carne y la belleza ornamental generan interés por esta especie. Dentro del proyecto denominado reproducción de Oscar (<em>Astronotus ocellatus</em>) y con el <strong>objetivo</strong> de generar aportes al paquete tecnológico de la especie <em>Astronotus ocellatus </em>como alternativa ornamental para reducir la presión pesquera en el río Bita, ubicado en el departamento del Vichada, Colombia, se realizó un ensayo experimental de piscicultura de esta especie en la estación piscícola de la Fundación Orinoquia, entre el 4 de febrero y 4 de junio de 2016, en Puerto Carreño, Vichada, Colombia. <strong>Métodos. S</strong>e desarrollaron actividades de adaptación de los ejemplares a piletas de cemento, identificación y aislamiento de parejas de reproductores, procesos de inducción hormonal, manejo de reproductores, reproducción, larvicultura y alevinaje, obteniendo datos productivos que aportan a consolidar mejores formas de producción. Se presenta también el desarrollo de protocolos de manejo para realizar todo el proceso de cultivo, con el fin de que puedan replicar resultados en la región orinoquense y en otras zonas del país, propuesto especialmente como alternativa para evitar la extracción indiscriminada de este recurso en el rio Bita dentro del Proyecto Río protegido. <strong>Resultados. </strong>Se adaptaron reproductores a piletas de cemento logrando mantener en buen estado una densidad de 1pez/m<sup>2</sup>, también se obtuvo la formación de tres parejas de reproductores que realizaron desoves exitosos en confinamiento, con camadas promedio de 1395,67±417,26 huevos cada pareja, En cuanto a los procesos de inducción hormonal se observó que ayudaron a mejorar la frecuencia reproductiva a 36,66±11,91 días; los procesos de incubación, larvicultura y alevinaje se llevaron a cabo en acuarios de 75 L, con desarrollo ontogénico y absorción del saco vitelino a las 72 horas. La primera alimentación se realizó con nauplios Artemia por 30 días y finalizando con la transición a alimento comercial (50% proteína) consiguiendo alevinos de 5,0±0,2 cm y 2,22±0,1 g a los 75 días pos-eclosión, con una sobrevivencia promedio de 54,22±19,17%. <strong>Conclusión</strong>. Se puede lograr la reproducción en cautiverio de esta especie, teniendo en cuenta una adecuada ambientación de los estanques o piletas y la formación de parejas reproductoras, así como el control de la incubación, larvicultura y alevinaje en acuarios, logrando finalmente un proceso aplicable a la producción de esta especie en sistemas de acuicultura.</p><p> <strong>Palabras claves:</strong> Río Bita, Acuicultura, especies ícticas tropicales, cíclidos</p><p align="center"><strong>CONTRIBUTIONS TO THE KNOWLEDGE OF CAPTIVE BREEDING OSCAR FISH (<em>Astronotus ocellatus</em>) </strong></p> Edisson Castillo-Pastuzan ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2898 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DEL RECAMBIO DE AGUA SOBRE LA SUPERVIVENCIA DEL COPEPODO Parvocalanus crassirostris http://revistas.udenar.edu.co/index.php/revip/article/view/2899 <p><strong>Introducción.</strong> Los nauplios de copépodos generan grandes beneficios en larvicultura de peces marinos, no obstante, se requieren gran cantidad de adultos para producir los nauplios necesarios como alimento vivo. Es por ello que la supervivencia de los nauplios es muy importante dentro del proceso productivo, la cual es muy dependiente de la calidad del agua de los cultivos. <strong>Objetivo.</strong> Evaluar dos métodos de recambio de agua sobre la sobrevivencia desde nauplios hasta adultos del copépodo <em>Parvocalanus crassirostris</em> bajo condiciones de cultivo <strong>Métodos.</strong> Se utilizaron tres unidades experimentales por tratamiento, las cuales fueron constituidas por acuarios de plástico de 40 L, sembrados con 1.5 Nauplios.ml<sup>-1</sup>. La alimentación fue realizada utilizando 15 mg peso seco de una mezcla (50:50) de <em>Isochrysis galbana</em> y <em>Tetraselsmis suecica</em>. Los tratamientos fueron recambio del 100% al día 3 de cultivo (T1), recambio del 10, 20, 40, 50 y 60% durante los días 1, 2, 3, 4, 5 respectivamente (T2). Adicionalmente se realizó un control sin recambio (T3). Se determinó la sobrevivencia después del periodo experimental (6 días). <strong>Resultados.</strong> La mayor sobrevivencia se registró en los tratamientos T1 y T2 (35,5 ± 4,82 y 35,6 ± 2,99%, respectivamente), no presentando diferencias significativas entre ellos (p&gt;0,05). El tratamiento sin recambio presentó un promedio significativamente más bajo de 26,0 ± 4,58% (p&lt;0,05). La temperatura,  pH y salinidad del agua permaneció en 24,4 ± 0,1 ppt, 7,9 ± 0,1 y 24,2 ± 0,6°C, respectivamente. <strong>Conclusión. </strong>Los mejores métodos para hacer recambio del agua son recambios diarios o un solo recambio total del agua del tanque a los tres días de cultivo, lo anterior genera los mayores valores de sobrevivencia de nauplios hasta adultos, y por consiguiente mayor producción de copépodos. Esta investigación, abre posibilidades de mejorar la producción de copépodos al incrementar el control de la calidad del agua en los cultivos de la especie trabajada.</p><p><strong> </strong><strong>Palabras Clave: </strong>Alimento vivo, cultivo, calanoide, marino</p><p align="center"><strong>THE EFFECT OF WATER EXCHANGE ON <em>Parvocalanus crassirostris </em>COPEPOD SURVIVAL<em></em></strong></p> Gustavo Adolfo Torres-Valencia ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2899 Tue, 06 Dec 2016 20:36:03 -0500 AVANCES EN EL CULTIVO DEL ROTÍFERO Brachionus calyciflorus EN CONDICIONES DE LABORATORIO http://revistas.udenar.edu.co/index.php/revip/article/view/2900 <p><strong>Introducción.</strong> Los rotíferos <em>Brachionus</em> han sido ampliamente utilizados en larvicultura de peces, los cuales deben ser producidos a alta densidad. Con altas densidades de rotíferos se disminuye el requerimiento de espacio necesario, así como también facilita el manejo de estos, en términos de cosecha, limpieza, enriquecimiento, entre otros. Además la población presa se incrementa substancialmente la cual asegura el hallazgo de alimento y supervivencia del cultivo. No obstante llegar a una alta densidad de rotiferos no es fácil y es muy limitada la literatura que muestre evaluación de aspectos clave para el cultivo de estos organismos.  En el presente estudio se realizó un experimento con el fin de incrementar la densidad del cultivo de rotíferos. Objetivo. Evaluar el efecto de dos acidificantes del cultivo de rotíferos <em>Brachuonus calyciflorus</em> sobre su crecimiento poblacional. <strong>Metodología. </strong>Dar a conocer una forma sencilla para incrementar la densidad de rotíferos hasta lograr un número máximo de rotiferos por mililitro. Debido a que el pH del cultivo de rotíferos tiende a incrementar, se evaluó la adición de dos tipos de ácidos que permitan reajustar tres veces al día el pH del cultivo en un nivel alrededor de 7.  Los dos tratamientos fueron realizados por triplicado, así, T1: Producto comercial “acid Buffer” (Seachem®) y T2 ácido clorhídrico diluido. Las unidades experimentales fueron desarrolladas en recipientes plásticos de 400 ml, con una densidad inicial de 1100 rotíferos/ml. Los cultivos fueron alimentados diariamente con condensados de la microalga <em>Scenedesmus</em> sp. (1x10<sup>8</sup> células/ml) a una tasa de 0,25 µl/rotifero. Adicional al experimento anterior, se realizó un cultivo bajo las mismas condiciones del T1 (acid buffer), pero con una densidad inicial de 400 rot/ml más una esponja a manera de trampa de vorticelas o protozoarios. Cada uno de los cultivos fue monitoreado diariamente, determinando el número de rotíferos por mililitro. La temperatura fue controlada a 25°C.<strong> Resultados.</strong> Se evidenció que no hubo diferencia estadística entre los dos tratamientos de ácido. Presentando valores de 2357,8 ± 317,0 y 2198,6 ± 114,6 rotíferos/ml para “acid” buffer y HCL diluido, respectivamente, 3 días después de la eclosión. En cuanto a las unidades de observación con trampa de vorticela, presentaron un crecimiento continuo hasta los 4 días de cultivo, para alcanzar 2625,8 ± 63,5 rotíferos.ml<sup>-1</sup>. Adicionalmente se observó  una gran disminución de los protozoarios presentes en los cultivos. <strong>Conclusión. </strong>Ambos tipos de ácidos evaluados pueden generar una alta densidad de rotíferos en cultivo. Una trampa de vorticela puede disminuir la cantidad de protozoarios beneficiando el crecimiento de los rotíferos en cultivo.</p><p><strong>Palabras clave: </strong>producción, densidad, alimento vivo, zooplancton</p><p align="center"><strong>ADVANCES IN ROTIFER <em>Brachionus calyciflorus</em> CULTURE UNDER LABORATORY CONDITIONS <em></em></strong></p> Gustavo Adolfo Torres-Valencia ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2900 Tue, 06 Dec 2016 20:36:03 -0500 ESTANDARIZACIÓN DEL MÉTODO DE SEXAJE POR ENDOSCOPIA, EN PECES Arapaima gigas, DEL PUTUMAYO, COLOMBIA http://revistas.udenar.edu.co/index.php/revip/article/view/2994 <div class="WordSection1"><p><strong>Introducción. </strong>La especie íctica Pirarucú (<em>Arapaima gigas</em>) se encuentra amenazada y su población natural ha disminuido considerablemente, así mismo la producción de alevinos no cubre la demanda existente, debido en gran parte a la dificultad para conformar parejas reproductivamente viables, pues no es posible identificar el sexo mediante características fenotípicas a una edad temprana. <strong>Objetivo. </strong>Realizar sexaje por endoscopia, que aún  es de carácter experimental para estandarizar  esta técnica. <strong>Métodos. </strong>Se seleccionó 14 animales de la estación Aquamazonia, ubicada en el municipio de Villa Garzón (Putumayo, Colombia); distribuidos en tres grupos según el peso y el grado de desarrollo corporal así: Grupo 1, seis especímenes de 10,6 kg a 13,15 kg, Grupo 2, cinco ejemplares de 16,2 kg a 26,1 kg, y tres reproductores de 57 kg a 85,2 kg como Grupo 3. El procedimiento se aplicó en animales destinados al sacrificio, previo los protocolos de anestesia para esto se utilizó eugenol con una dosis de 50 a 100 ppm y cumpliendo lo preceptuado en la ley 84 de 1989 del Congreso de Colombia. Se utilizó un equipo de endoscopia tipo semirrígido, que consta de cámara iluminada de 6 mm, dentro de una vaina plástica transparente con 10 mm de diámetro, a través de la cual se insufla CO2; las imágenes registradas por la cámara se tradujeron en un monitor convencional, con los instrumentos quirúrgicos esterilizados en frío y una vez aplicada la anestesia en plano profundo, se procedió a realizar la celioscopia, en decúbito lateral izquierdo y preparación del área quirúrgica con solución salina estéril. <strong>Resultados. </strong>Entre más joven e inmaduro es el  espécimen,</p></div><br clear="all" /><p> </p><p>más cercano se debe realizar a la aleta pélvica del lado izquierdo, en razón de la ubicación de la gónada, que en estas edades es más corta y poco desarrollada, pues para ejemplares de 10 kg a 14 kg, el sitio ideal es el ubicado una escama hacia craneal y una más hacia dorsal de la aleta pélvica, para los ejemplares de 16 kg a 26 kg, se encontró que el sitio ideal estaba ubicado una o dos escamas hacia craneal y dos escamas hacia dorsal y para el caso de peces más grandes, de más de 57 kg, el sitio ideal para la trocarización fue de tres escamas hacia craneal y tres hacia dorsal de la aleta pélvica, en razón al gran desarrollo de la ganada funcional (izquierda), que marca su madurez sexual. <strong>Conclusión</strong>. La ubicación del sitio de punción para trocarización para introducir la sonda endoscópica, se determinó tomando como guía la evaluación previa de peces sacrificados para el consumo. Luego del análisis descriptivo, se encontró que éste sitio depende del tamaño y el grado de madurez sexual.</p><p><strong>Palabras clave: </strong>género, juveniles, pirarucú</p><p align="center"><strong>STANDARDIZATION METHOD ENDOSCOPIA SEXING IN FISH A<em>rapaima gigas</em>, PUTUMAYO, COLOMBIA</strong></p> Wilmer Rene Sanguino-Ortiz ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2994 Tue, 06 Dec 2016 20:36:03 -0500 PCR Y qPCR PARA DETECCIÓN DE Aeromonas salmonicida Y Flavobacterium psychrophilum EN Oncorhynchus mykis http://revistas.udenar.edu.co/index.php/revip/article/view/2901 <p><strong>Introducción. </strong>Entre los principales patógenos involucrados en infecciones de trucha arcoíris (<em>Oncorhynchus mykiss</em>) se incluyen las especies de bacterias Gram negativas como <em>Aeromonas salmonicida </em>y<em> Flavobacterium psychrophilum</em>. Estos son los agentes etiológicos de la forunculosis y de la enfermedad bacteriana de aguas frías respectivamente, que se caracterizan por la presencia de anorexia, letargia, septicemia, lesiones necróticas y hemorrágicas. Los métodos comunes de identificación de estas especies requieren largo tiempo y trabajo, y son difíciles de implementar por la variedad de perfiles bioquímicos y la ausencia de medios selectivos eficientes. La reacción en cadena de la polimerasa (PCR) y la PCR en tiempo real (qPCR) se han posicionado como importantes herramientas en la identificación de especies bacterianas por la especificidad de la reacción.<strong> Objetivo.</strong> Diseñar y evaluar protocolos de PCR y qPCR para la detección de <em>A. salmonicida </em>y<em> F. psychrophilim </em>en <em>O. mykiss. </em><strong>Métodos. </strong>Se utilizaron como control las cepas registradas <em>Flavobacterium psuchophilum</em> ATCC®45510 y <em>Aeromonas salmonicida </em>ATCC®33658; y cepas control para pruebas de especificidad: <em>Aeromonas hydrophila</em>, <em>A. caviae</em>, <em>Streptococcus agalactie</em>, <em>S. pneumoniea</em>, <em>S. mutans</em>, <em>S. iniae</em>, <em>S. pyogenes</em>, y<em> </em><em>Edwardsiella tarda</em>, las cuales fueron reconstituidas y cultivadas según las especificaciones para cada cepa.  Se realizó la extracción de DNA bacteriano mediante el equipo automatizado QIAcube utilizando el Kit comercial DNeasy® Blood &amp; Tissue siguiendo el protocolo para extracción de DNA bacteriano. La concentración y pureza del DNA fue medida utilizando el espectrofotómetro NanoDrop 2000 y se verifico integridad del DNA por medio de electroforesis en gel de agarosa 1X. Cuatro secuencias de oligonucleótidos fueron sintetizadas. Para <em>A. salmonicida </em>fueron sintetizadas las secuencias Forward- 5'-CACACTGAGCCTGTTCCAGA-3', y Reverse- 5'-  AGTCAGCTCGCCAAACAGAT-3' a partir del gen fstB (AM712656.1) esperando un producto de 124 pb. Para <em>F. psychrophilum</em> Forward – 5´- AGACTCTATCGCAGCCGTTAC 3´  y Reverse - 5'-  GTCGTCGTCTGAATCCTCA 3´, a partir del gen gyrA (<a href="http://www.ncbi.nlm.nih.gov/projects/sviewer/sequence.cgi?id=gi|149771382&amp;format=fasta&amp;filename=CAL42851.1.fa&amp;ranges=0-870" target="_blank">CAL42851.1</a>); Esperando un producto amplificado de 175 pb. Las sondas utilizadas en la qPCR fueron marcadas con VIC y FAM como reporteros de amplificación. Las reacciones fueron llevadas a un volumen final de 25 µL conteniendo: &gt;10 ng de DNA, 10X taq buffer, dNTPs (0,2 mM), primer forward (0,5 µM), Primer Reverse (0,5 µM), MgCl<sub>2 </sub>(2,5 mM), taq polimerasa (1,25 U). Las reacciones fueron llevadas a cabo en el termociclador C1000 Touch™ Bio-Rad con el siguiente perfil térmico: 35 ciclos a 95°C por 30 segundos, 58°C por 30 segundos, y a 72°C por 30 s. Los productos amplificados por PCR fueron separados por electroforesis en un gel de agarosa al 1,5%. <strong>Resultados. </strong>Se obtuvo una especificidad del 100% para cada par de “primers” evaluado con las cepas bacterianas de referencia. La concentración mínima de detección para ambos agentes fue en diluciones de 1:10000 tanto para PCR como para qPCR.<strong> Conclusión-</strong> Los resultados obtenidos demostraron que los protocolos diseñados y evaluados son específicos y sensibles para la detección de <em>A. salmonicida </em>y<em> F. psychrophilum</em>, convirtiéndolos en una herramienta diagnóstica de detección rápida y específica</p><p><strong>Palabras clave:</strong> biología molecular, diagnostico, infección, patógeno, trucha arcoíris</p><p align="center"><strong><em>PCR and qPCR FOR DETECTION OF Aeromonas salmonicida</em></strong><strong> AND <em>Flavobacterium psychrophilum </em>in <em>Oncorhynchus mykiss</em></strong></p> Juan D. Ospina-Ramirez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2901 Tue, 06 Dec 2016 20:36:03 -0500 BIODIVERSIDAD BARCODE EN GRUPOS POBLACIONALES DE SABALETA Brycon henni (Pisces: Characidae) http://revistas.udenar.edu.co/index.php/revip/article/view/2902 <p><strong>Introducción</strong>: Los linajes en la mayoría de los peces están siendo dilucidados para su clasificación por medio de secuencias moleculares. El ADN mitocondrial (mtADN) cuenta con una secuencia de nucleótidos específicos <em>Barcode</em> que permite concretar los linajes en ellos. <strong>Objetivo</strong>: Conocer la presencia del linaje genético intra e inter específico, entre los grupos poblacionales de la sabaleta <em>Brycon henni</em> y especies del mismo género, mediante la comparación de secuencias mtADN de la región citocromo oxidasa I. <strong>Métodos</strong>: 40 individuos de sabaleta, como grupo intra especifico de tres quebradas del río Cauca (Pitanjá, Guaracú y Sopetrana) y una del río Magdalena (Concepción) fueron analizados. El grupo de comparación inter especifico incluyó nueve individuos de dorada <em>Brycon moorei</em> y cinco individuos de yamú <em>Brycon amazonicus</em>. De cada individuo, se extrajo el ADN, mediante un kit comercial (Quiagen<sup>®</sup>), a partir de muestras de aleta. Se amplificó la región citocromo oxidasa I (650pb), mediante PCR con iniciadores universales (FF2d TTCTCCACCAACCACAARGAYATYGG; FR1d CACCTCAGGGTGTCCGAARAAYCARAA). La amplificación por PCR fue realizada en volúmenes de 12,5 µL e incluyo: 6,25 µL de 10% trehalosa, 2,00 µL agua ultra pura, 1,25 µL 10x buffer PCR (10 mM KCl, 10 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 20 mM Tris-HCl (pH 8,8), 2 mM M<sub>g</sub>SO<sub>4</sub>, 0,1% Triton X-100), 0,625 µL MgCl<sub>2</sub> (50 mM), 0,125 µL de cada iniciador universal (0,01 mM), 0,0625 µL de cada dNTP (10 mM) marcados con fluorocromos, 0,0625 µL de <em>Taq</em> DNA Polimerasa (Biolabs<sup>®</sup>) y 2,0 µL de ADN de cada individuo. El perfil de temperaturas en el termociclador fue: 94°C por 2 min, treinta y cinco  ciclos de 94°C por 30 s, 52°C por 40 s y 72°C por 1 min, con una extensión final de 72°C por 10 min. El amplicado se envió a secuenciación automática (Macrogen Inc). Obtenida la secuencia, se comparó entre los grupos de muestreo mediante el programa Mega7 para obtener un dendrograma. <strong>Resultados</strong>: Se presentó una separación de los grupos intra específicos de sabaleta, pertenecientes a las cuencas de los ríos Cauca y Magdalena. Así mismo, una separación entre las especies de dorada y yamú. <strong>Conclusión</strong>: Se evidenció una variabilidad genética entre los grupos poblacionales de sabaleta, provenientes de dos cuencas diferentes. Así mismo, una separación de especies dentro del mismo género, lo cual soporta la idea de biodiversidad y taxonomía en ambientes naturales. </p><p><strong>Palabras Clave:</strong> código de barras, peces, mtADN, citocromo oxidasa I</p><p align="center"><strong>BARCODE BIODIVERSITY IN POPULATION GROUPS OF SABALETA <em>Brycon henni</em> (Pisces: Characidae)</strong></p> Hermes Rafael Pineda-Santis ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2902 Tue, 06 Dec 2016 20:36:03 -0500 DIVERSIDAD GENÉTICA DE CUATRO POBLACIONES DE TILAPIA (Oreochromis ssp) EN EL DEPARTAMENTO DE ANTIOQUIA (COLOMBIA) http://revistas.udenar.edu.co/index.php/revip/article/view/2903 <p><strong>Objetivo</strong>. Analizar la diversidad genética y la estructura poblacional de los reproductores de cuatro granjas dedicadas a la producción de alevinos de tilapia (tres de variedad roja y una nilótica) en el Departamento de Antioquia. <strong>Métodos</strong>. Se genotipificaron entre 32 y 42 individuos por población y se utilizaron 24 microsatélites de 13 grupos de ligamiento, amplificados con cebadores marcados con fluorocromos en cinco reacciones múltiples, los cuales fueron analizados mediante electroforesis capilar. Se calculó el número de alelos por locus, número efectivo de alelos, heterocigosidad observada, heterocigosidad esperada no sesgada, equilibrio Hardy-Weinberg y se llevó a cabo un Análisis de Varianza Molecular (AMOVA) <strong>Resultados</strong>. Dos de los marcadores utilizados no pudieron ser amplificados (UNH208 y UNH222), los 22 marcadores restantes (GM234, GM407, OMO032, OMO039, OMO175, OMO194, OMO228, UNH104, UNH106, UNH108, UNH118, UNH123, UNH124, UNH129, UNH159, UNH160, UNH166, UNH172, UNH207, UNH211, UNH216, UNH231) fueron polimórficos. El número promedio de alelos por locus varió entre 5,77 y 7,91. El mayor número total de alelos (17 alelos), se encontró en el locus UNH 211, mientras que el menor número de alelos se observó en el locus OMO032 (cuatro alelos).  Todos los 22 loci analizados (con la excepción de los loci GM234 y OMO032) presentaron por lo menos 1 alelo privado por población. En el locus OMO228, se encontraron 7 alelos privados y la población tilapia nilótica presentó 22 alelos privados. El número de alelos efectivos promedio fue siempre menor al número de alelos observado y estuvo entre 3,37 y 4,03. Se registraron desviaciones significativas en el equilibrio Hardy-Weinberg, en 44 de los 88 locus analizados. De estos, 42 casos mostraron deficiencias de heterocigotos. Los loci GM407, OMO175, UNH104, UNH108, UNH118, UNH123, UNH124, UNH129 y UNH166, mostraron evidencias de alelos nulos. La heterocigosidad esperada estuvo entre 0,6504 y 0,6748 por población, mientras que la heterocigosidad observada estuvo en el rango 0,601 y 0,649. El nivel observado de heterocigosidad, se desvió significativamente del esperado en las cuatro poblaciones analizadas. El valor de Fst para todas las poblaciones en conjunto (sin alelos nulos) fue de 0,0766 (intervalo de confianza de 95%, 0,05092 - 0,10289). Según el análisis de varianza molecular (AMOVA), la mayor fuente de variación se encontró entre individuos, comparados con los grupos formados por las poblaciones y los individuos al interior de las poblaciones. El valor de la distancia de Nei para las poblaciones rojas estuvo en el rango entre 0,031 y 0,08 comparado con estas distancias para la población nilótica y las poblaciones rojas que se encontró entre 0,43 y 0,54. <strong>Conclusión</strong>. Para las poblaciones de tilapia del Departamento de Antioquia analizadas en el presente estudio, la heterocigocidad fue media-alta, diferenciándose claramente la población tilapia nilótica mientras que las poblaciones rojas presentaron baja estructuración.</p><p><strong>Palabras clave:</strong> genotipado, marcadores ADN, microsatélites, variación</p><p align="center"><strong>GENETIC DIVERSITY OF FOUR POPULATIONS OF TILAPIA (<em>Oreochromis</em> ssp.) IN THE DEPARTMENT OF ANTIOQUIA (COLOMBIA)</strong></p> Andrés Felipe Montoya-López ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2903 Tue, 06 Dec 2016 20:36:03 -0500 CÓDIGO DE BARRAS DE ADN EN TILAPIAS FERALES DE EMBALSES DEL DEPARTAMENTO DE ANTIOQUIA (COLOMBIA) http://revistas.udenar.edu.co/index.php/revip/article/view/2904 <p><strong>Introducción. </strong>Las tilapias son ciclidos nativos de África que han sido introducidos a la mayoría de regiones tropicales y subtropicales para mejorar la productividad de la acuicultura. <strong>O</strong><strong>bjetivo.</strong> Identificar mediante el ADN mitocondrial, las especies de tilapia que se encuentran en estado silvestres en algunos embalses del Departamento de Antioquia. <strong>Métodos.</strong> 137 individuos de la familia Cichlidae fueron capturados en los embalses: Peñol-Guatapé (12 individuos), Playas (44), San Lorenzo (17), Punchiná (12), Porce II (17), y Porce III (35), del Departamento de Antioquia. A cada individuo se le tomó una muestra de la aleta anal de aproximadamente un centímetro cuadrado, conservadas en etanol 96%, transportadas al laboratorio y congeladas a -80°C hasta su procesamiento. El ADN genómico, fue extraído mediante el kit DNeasy (Qiagen) para sangre y tejido en sistema automatizado QIACUBE. Para la amplificación de una región de 650 pb del gen citocromo C oxidasa subunidad I, se utilizaron los iniciadores: FishF1, FishF2, FishR1, FishR2. La mezcla para la PCR utilizada fue: 10 µL de PCR Master Mix 2X (Thermo Scientific), primer forward (0,5) 1 µL, primer reverse (0,5) 1 µL, ADN 2 µL y agua libre de nucleasas (6 µL) para un volumen total de reacción de 20 µL. El perfil térmico aplicado fue: 2 minutos a 95ºC, 35 ciclos de 30 segundos a 94ºC, 30 segundos a 52ºC, 1 minuto a 72ºC, 10 minutos a 72ºC. Los productos visibles de alta integridad, fueron enviados a secuenciación a Macrogen (Corea). La alineación de los “reads” así como la obtención de las secuencias consenso se llevó a cabo mediante el programa Geneious versión 8.1.5. Las secuencias fueron comparadas con las registradas en las bases de datos de Bold Systems y NCBI (se consideró la identificación a nivel de especie con una similaridad total de 100%). Posteriormente, algunas secuencias seleccionadas como representativas de cada haplotipo fueron analizadas junto con las secuencias obtenidas de los embalses de Antioquia mediante una reconstrucción filogenética a partir del método estadístico de máxima verosimilitud con el modelo de Kimura 2-parametros en el programa Mega versión 6.0. <strong>Resultados.</strong> Las secuencias consideradas en los análisis fueron las que mostraron menor ruido en los cromatogramas y de las cuales se pudo obtener una secuencia consenso. De esta manera, fue posible obtener “reads” de alta calidad provenientes de 81 individuos de la familia Cichlidae. De estos, 77 haplotipos correspondieron a dos géneros y cinco especies: <em>Oreochromis aureus</em>, <em>Oreochromis niloticus</em>, <em>Oreochromis urolepis</em>, <em>Oreochromis mossambicus</em> y <em>Coptodon rendalli</em>. Los embalses que presentaron mayor número de haplotipos diferentes fueron: Peñol-Guatapé (cuatro), Punchiná (tres) y Porce III (tres). <strong>Conclusión.</strong> En el embalse del Peñol-Guatapé, fue posible registrar cuatro de los cinco haplotipos hallados en todos los embalses muestreados del Departamento de Antioquia, mientras que los haplotipos de las especies <em>C. rendalli</em> y <em>O. aureus,</em> tuvieron la mayor distribución geográfica, ya que fueron registrados en cinco de los seis embalses muestrados.</p><p><strong>Palabras clave:</strong> ciclidos, identificación molecular, citocromo C oxidasa subunidad I, poblaciones silvestres</p><p align="center"><strong>DNA BARCODING OF FERAL TILAPIAS IN RESERVOIRS FROM THE DEPARTMENT OF ANTIOQUIA (COLOMBIA)</strong></p> Andrés Felipe Montoya-López ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2904 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE LA DENSIDAD DE ADULTOS SOBRE LA PRODUCCIÓN DE NAUPLIOS DEL COPEPODO Parvocalanus crassirostris http://revistas.udenar.edu.co/index.php/revip/article/view/2905 <p align="center"><strong> </strong></p><p><strong>Introducción.</strong> El copépodo <em>Parvocalanus crassirostris</em> es un microcrustaceo herbívoro<del cite="mailto:An%C3%B3nimo" datetime="2016-09-11T18:23">,</del> encontrado en regiones tropicales y subtropicales, incluyendo al Pacífico Colombiano, el cual ha ganado gran importancia en la larvicultura de peces marinos de boca pequeña, en la primera alimentación. Sin embargo, su cultivo es difícil y la producción de nauplios depende del control preciso de las condiciones del cultivo. La densidad de siembra de adultos de copépodos puede afectar significativamente la reproducción de los copépodos. <strong>Objetivo.</strong> Evaluar el efecto de la densidad de siembra sobre la producción de nauplios del copépodo marino <em>Parvocalanus crassirostris</em>. <strong>Métodos.</strong> Se sembró adultos de copépodos bajo tres diferentes densidades: 100, 200 y 300 adultos.L<sup>-1 </sup>(T1, T2 y T3, respectivamente). Los tratamientos fueron evaluados por triplicado, determinando diariamente el número de descendientes por hembra. Las unidades experimentales fueron constituidas por tanques cilindrocónicos de 1 m<sup>3</sup>, alimentando diariamente los copépodos con cultivos de microalgas <em>Isochrysis galbana</em> a razón de 1x10<sup>5</sup> cel.ml<sup>-1</sup>. El periodo de estudio fue de 7 días. Se monitoreó los parámetros de temperatura, pH, oxígeno disuelto y salinidad. <strong>Resultados.</strong> La densidad de siembra tuvo efectos significativos (p&lt;0,05) sobre la producción de huevos y nauplios. El tratamiento T1, mostró la mayor producción de nauplios (186.7 ± 21.5 Nauplius.L<sup>-1</sup>.hembra<sup>-1</sup>. día<sup>-1</sup>), comparado con el T2 y T3 (153 ± 20.1 y 127.3 ± 15.7 Nauplios.L<sup>-1</sup>.hembra<sup>-1</sup>. día<sup>-1</sup>, respectivamente). La temperatura del agua permaneció baja durante el experimento (24,2 ± 0,2°C), la salinidad, oxígeno disuelto y pH presentaron valores de 28 ± 0,1 ppt, 4,6 ± 0,7 mg.L<sup>-1</sup>y 7,9 ± 0,1 respectivamente. <strong>Conclusión. </strong>La densidad de siembra tiene un efecto sobre la producción de nauplios diarios en el copépodo <em>P. crassirostris</em>, presentando mayor producción por hembra cuando se manejan a densidades más bajas. Lo anterior repercutirá en el mejoramiento de las técnicas de cultivo, con el fin de incrementar la producción de nauplios como fuente de alimento para larvas de peces marinos. Se recomienda realizar estudios bajo temperaturas más altas, similares a las encontradas en el litoral del Pacifico Colombiano. </p><p><strong>Palabras Clave: </strong>Alimento vivo, cultivo, copepodos, marino.</p><p align="center"><strong>EFFECT OF ADULT DENSITY ON NAUPLII PRODUCTION OF THE COPEPOD <em>Parvocalanus crassirostris</em></strong></p> Gustavo Adolfo Torres-Valencia ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2905 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DEL ALMACENAMIENTO EN FRÍO SOBRE LA SOBREVIVENCIA DE NAUPLIOS DEL COPEPODO Parvocalanus crassirostris http://revistas.udenar.edu.co/index.php/revip/article/view/2906 <p><strong>Introducción. </strong>Uno de los retos a resolver para la tecnología de producción de copépodos es el desarrollo de técnicas de almacenamiento de huevos o nauplios, las cuales, facilitarían su uso en larvicultura. Los estadíos naupliares iniciales se utilizan como un primer alimento, no obstante, su rápido metabolismo los hace crecer en corto tiempo, dificultando su disponibilidad para las larvas en términos de tamaño durante la primera alimentación. Es por ello que en la presente investigación se determinó la temperatura más adecuada para almacenar los primeros estadíos naupliares del copépodo calanoide marino <em>Parvocalanus crassirostris</em>. <strong>Objetivo.</strong> Evaluar el efecto de tres temperaturas en la sobrevivencia de nauplios del copépodo marino <em>Parvocalanus crassirostris</em>. <strong>Métodos.</strong> Nauplios de uno y dos días de vida (Estadío I y II) fueron obtenidos de cultivos en tanques de 3 m<sup>3</sup>, los cuales fueron separados de los adultos utilizando mallas de nylon de 100 y 40 µm. Se distribuyeron en 9 recipientes de 3 L a una densidad de 1.5x10<sup>4 </sup>nauplios.ml<sup>-1</sup>. Luego se sumergieron parcialmente en neveras de poliestireno que contenían a temperatura ambiente de 26 °C (tres recipientes por nevera), en oscuridad y aireación constante para cada unidad experimental. Se utilizaron tres tratamientos por triplicado, 9°C (T1), 12°C (T2) y 15°C (T3), la cual fue ajustada utilizando botellas plásticas llenas de agua congelada, las cuales eran colocadas dentro de las neveras, con el fin de disminuir la temperatura de los recipientes a una tasa de 4 °C por hora, hasta llegar a la temperatura deseada. La temperatura fue monitoreada cada 2 horas. Se determinó la sobrevivencia realizando un conteo de los nauplios vivos y muertos al microscopio. <strong>Resultados.</strong> En el primer día de almacenamiento los tratamientos T2 y T3 presentaron la mayor sobrevivencia (94.3 ± 3.7 y 98.7 ± 2.3% respectivamente). En cuanto al T1 presentó el menor valor (11.3 ± 2.3%). A los 2 días de almacenamiento el mayor valor lo presentó el T3 seguido de T2 y T1 (96.6 ± 2.3, 84.9 ± 1.3 y 5.8 ± 1.8%, respectivamente). El pH del experimento permaneció 7.9 ±0.1. El Oxígeno disuelto presentó valores más altos en los tratamientos con menor temperatura así, T1, T2 y T3 (10.3 ± 1.2, 8.8 ± 1.7 y 8.0 ± 1.2 mg.L<sup>-1</sup>). La salinidad permaneció constante en 25.5 ppt. <strong>Conclusión. </strong>La temperatura de 15°C genera mayor sobrevivencia, no obstante, la temperatura de 12°C generó igualmente una alta sobrevivencia. Es posible que al incrementar el tiempo y control de disminución de la temperatura se pueda mantener los rotíferos a temperaturas de 12°C por un periodo mayor de tiempo. La información obtenida abre una posibilidad de conservación de nauplios de copépodos, los cuales podrán ser utilizados en larvicultura. </p><p><strong>Palabras Clave: </strong>Conservación, baja temperatura, marino, calanoide</p><p align="center"><strong>EFFECT OF COLD STORING ON SURVIVAL OF <em>Parvocalanus crassirostris </em>COPEPOD NAUPLII</strong></p> Harold Julian Perez-Gutierrez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2906 Tue, 06 Dec 2016 20:36:03 -0500 COMPARACION DE LA SIEMBRA ENTRE ESTANQUES EN TIERRA Y JAULAS FLOTANTES EN YAMU Brycon amazonicus. http://revistas.udenar.edu.co/index.php/revip/article/view/2908 <p><strong>Introducción. </strong>El yamú es una especie nativa de la cuenca del río Orinoco y su prevalencia es mayor en afluentes de los ríos Meta, Ariari y Guaviare, en Colombia y los ríos Arauca y Apure, en Venezuela. Se concentran en el río Meta, en la época de inicio de las lluvias (abril y mayo), donde se han registrado hasta 10 toneladas/mes con talla total media de captura de 52 cm. Se distribuye de los 50 a 500 m.s.n.m. entre un rango de temperatura del agua de 26-30°C. <strong>Objetivo</strong>. Comparar dos sistemas de siembra, estanque en tierra y jaulas flotantes, en la etapa de alevinaje y pre-levante del yamu, <strong><em>Brycon amazonicus,</em></strong> en una granja piscícola del Ariari. <strong>Métodos</strong>.<strong> </strong>El experimento se llevó a cabo en la finca piscícola La Odonata, de la inspección de Cacayal, municipio de Lejanías, departamento del Meta, Colombia. Se utilizaron 3000 alevinos de yamú, provenientes de un mismo desove, con peso promedio de 1,5 g, los cuales se distribuyeron aleatoriamente en cuatro grupos de 750 individuos y posteriormente se ubicaron en dos estanques en tierra de 500 m<strong><sup>3</sup></strong> cada uno a una densidad de 1,5 alevinos/m<strong><sup>3 </sup></strong>y en dos jaulas de seis m<strong><sup>3</sup></strong> cada una, en sistema intensivo (125 alevinos /m<strong><sup>3</sup></strong>). La jaula fue construida en malla plástica de ojo de 4 mm, con sistema de flotación. Los peces fueron alimentados dos veces al día hasta aparente saciedad con dieta comercial extrudizada del 38% de proteína bruta, el consumo fue registrado diariamente. Se realizó muestreo del 5% de alevinos a los 25 días de sembrados, los cuales fueron pesados individualmente en balanza digital.   <strong>Resultados. </strong>Los pesos medios de los peces fueron 41,9±13,2 g para los peces en los estanques y 47,4±12,5 g para los mantenidos en las jaulas. <strong>Conclusiones. </strong>No hubo diferencia significativa entre los peces que se mantuvieron en jaulas y estanques, por lo tanto, se puede inferir que el yamú puede ser mantenido en jaulas durante la etapa de levante sin afectar sus parámetros zootécnicos y facilitando el manejo controlado en un menor espacio.</p><p><strong>Palabras clave:</strong> Orinoco, Meta, jaula, saciedad y levante</p><p align="center"><strong>COMPARISON BETWEEN STOCKING GROUND PONDS AND FLOATING CAGES IN YAMU <em>Brycon amazonicus.</em></strong></p><p> </p> Ricardo Murillo-Pacheco ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2908 Tue, 06 Dec 2016 20:36:03 -0500 ESTUDIO TÉCNICO-ECONÓMICO DE DORADA Brycon moorei EN TRES DENSIDADES DE SIEMBRA. http://revistas.udenar.edu.co/index.php/revip/article/view/2909 <p><strong>Introducción:</strong> La dorada (mueluda) es un pez nativo de gran importancia en la cuenca del río Magdalena, debido a la cultura de consumo y la adaptación al cautiverio. A pesar de lo anterior, se han publicado pocos trabajos sobre su manejo en confinamiento y, menos aún, sobre estudios económicos relacionados al cultivo. <strong>Objetivo:</strong> Evaluar el efectos de tres densidades de siembra sobre parámetros zootécnicos de la dorada y determinar los costos de producción del mejor tratamiento. <strong>Metodología:</strong> Un total de 19200 doradas, con peso promedio inicial 8±0,5 g y 5±1 cm de longitud total, fueron sembradas en nueve estanques en tierra de 800 m2 cada uno; se trabajaron tres tratamientos: T1 (1 pez/m2), T2 (2 peces/m2) y T3 (5 peces/m2); se evaluó crecimiento diario (CD); ganancia de peso (GP); conversión alimenticia (CA); biomasa (B) y sobrevivencia (%S). Se registraron semanalmente los principales parámetros del agua. Se utilizó alimento balanceado comercial, iniciando con 38% de proteína cruda (%PC), durante el primer mes; 30% de PC en el segundo mes y terminando con 25% de PC, hasta el día 80 de seguimiento. Se realizó el análisis de costos teniendo en cuenta la densidad T3 (5 peces/m2), pues T3 arrojó la mayor biomasa; se determinaron los ingresos, costo por  kg producido, porcentaje de costos de cada actividad frente a los costos totales, utilidades y rentabilidad. <strong>Resultados</strong>: Parámetros zootécnicos: Durante el período de cultivo<strong> l</strong>os análisis de calidad de agua se mantuvieron estables: oxígeno disuelto (OD) (6,5±1,2 mg/L); pH (6±1,4); temperatura (°C) (24±1,5°C); alcalinidad (Alk) y dureza (Dz) (17,8 mg CaCO3/L) y NH3 (0,002 mg/L). Los resultados obtenidos fueron: peso y longitud total, en g y cm respectivamente, para T1: 321,25 y 27,71, para T2: 383,35 y 28,15, y para T3: 283,28 y 26,40. La GP en g fue, para T1: 313,25; T2: 344,35 y T3: 275,28. Ganancia diaria en g/día, 4,01 para T1; 4,40 para T2 y 3,54 para T3. CA: 1,29 para T1; 1,14 para T2 y 1,32 para T3. La B, en kg fue, para T1 de 257; T2: 564 kg y T3: 1.133 kg.  El %S fue del 98% para T1 y T2, y para T3 fue de 95%. Las diferencias entre los tres tratamientos no fueron significativas (p&gt;0,05), a excepción de la biomasa: en T3 fue significativamente (p&lt;0,05) mayor a T1 y T2. Resultados económicos para T3 (resultado de mayor biomasa): Ingresos $7´750.404; Costo kg de pescado eviscerado $5.526; utilidad neta $487.715; rentabilidad neta 6,29%. <strong>Conclusión.</strong> La densidad de siembra no afectó los parámetros zootécnicos medidos, a excepción de la biomasa, la cual tuvo diferencias significativas entre los tratamientos. El T3 presentó un mejor desempeño zootécnico y económico, lo cual invita a realizar estudios a mayores densidades de siembra y mayor tiempo de cultivo.</p><p><strong>Palabras claves:</strong> densidad, parámetros zootécnicos, costos de producción</p><p align="center"><strong>TECHNICAL AND ECONOMIC STUDY OF DORADA <em>Brycon moorei</em> IN THREE STOCKING DENSITIES</strong></p><p align="center"><sup> </sup></p> Nicolás Rodríguez-Franco ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2909 Tue, 06 Dec 2016 20:36:03 -0500 Oreochromis sp CULTIVADA EN BIOFLOC, EVALUACIÓN DE SU DESEMPEÑO Y CALIDAD DE AGUA. http://revistas.udenar.edu.co/index.php/revip/article/view/2910 <p><strong>Introducción.</strong> Reducir el uso del agua y de antibióticos son objetivos de la acuicultura moderna; el sistema biofloc se convierte en una posible solución por su bajo consumo de agua; además se conoce que los probióticos tienen efectos benéficos en peces.<strong> Objetivo. </strong>Evaluar el comportamiento zootécnico y calidad del agua en un cultivo de <em>Oreochromis spp </em>(tilapia roja) en biofloc con la inclusión de probióticos.<strong> Métodos. </strong>Peces con pesos entre 12 a 17 (g), en una densidad de 20 peces por unidad experimental de 700 L y distribuidos en un diseño completamente aleatorizado, se ajustaron en cuatro tratamientos, el Tratamiento 1 (TTO-1) fue BFT + cepa nativa 0-18 (bacillus+BAL); TTO-2, BFT + cepa nativa 0-13 (bacillus); TTO-3, BFT + bacteria acido lácticas (BAL) y el TTO-4, solo BFT que sirvió como control. Se evaluó ganancia diaria de peso (GDP), conversión alimenticia (CA), sobrevivencia (%S) entre otras; el experimento se llevó a cabo durante 60 días; se alimentó hasta aparente saciedad durante todo el ensayo; el concentrado utilizado fue del 32% de PB y se registraron semanalmente: pH, oxígeno disuelto (OD), amonio (N-NH<sub>4</sub><sup>+</sup>), sedimentación, entre otros, como parámetros de calidad de agua.<strong> Resultados. </strong>El TTO-1, presentó significativamente (p&lt;0.05) la mejor GDP con 2,89 (g/día); %S, fue estadísticamente significativa (p&lt;0,05) entre los tratamientos, TTO-3 (98%), con respecto a TTO-2 y TTO-4; la CA fue mejor en el TTO-1 (0,82), pero sin diferencias significativas con los demás tratamientos. Los resultados de calidad de agua, solo presentaron diferencias significativas (p&lt;0,05) en el parámetro sedimentación la cual fue mayor en el TTO1 (48 cm).<strong> Conclusión.  </strong>Bajo estas condiciones experimentales se puede asegurar que la adición de probióticos al biofloc favoreció los principales parámetros zootécnicos evaluados, por ejemplo los valores de GDP son mejores que los reportados para sistemas intensivos y superintensivos de esta especie.</p><p><strong>Palabras clave</strong>: peces, microorganismos eficientes, cultivo intensivo, flóculos</p><p align="center"><strong><em>Oreochromis sp </em></strong><strong>CULTURED IN BIOFLOC SYSTEM, PERFORMANCE EVALUATION AND WATER QUALITY.</strong></p><p align="center"><strong> </strong></p> Carlos Arturo David-Ruales ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2910 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DE INOCUIDAD Y PARÁMETROS ZOOTÉCNICOS EN ALEVINOS DE TILAPIA (Oreochromis sp) SUPLEMENTADAS CON PROBIÓTICOS http://revistas.udenar.edu.co/index.php/revip/article/view/2911 <p><strong>Introducción</strong>: Los probióticos son microorganismos benéficos normalmente bacterias lácticas y algunos géneros de bacilos esporulados, que consumidos en cantidades adecuadas favorecen la salud y el bienestar animal, promoviendo el aumento de las variables zootécnicas en animales monogastricos, reflejadas directamente en producción animal. Objetivo: En esta investigación se evaluó el efecto del consumo de microorganismos probióticos microencapsulados administrados en la dieta sobre la calidad microbiológica y sobre algunos parámetros zootécnicos de alevinos de tilapia roja (<em>Oreochromis sp)</em>.  <strong>Metodología</strong>: Se fabricaron dos dietas extruidas experimentales, con 42% de proteína bruta con 95% de digestibilidad, calculada in vivo y 4765,8 kcal de energía bruta/kg. Una de las dietas fue suplementada con 1% de probióticos.  Las cepas empleadas como probióticas fueron aisladas de intestino de tilapia en estado juvenil: <em>Bacillus megaterium, Bacillus polymyxa </em>y <em>Lactobacillus delbrueckii,</em> y se administraron a una concentración de 1x10<em><sup>7</sup></em> UFC/g. <em> </em>El ensayo se realizó en la estación experimental de la Corporación Universitaria Lasallista; se utilizaron 631 alevinos de tilapia roja, con un peso promedio de 0,43 g de peso vivo, los cuales fueron divididos en 4 tanques con un volumen aproximado de 700 L cada uno,  asignando dos a la dieta con probióticos y dos a la dieta sin probióticos. Durante los 40 días del ensayo los animales se mantuvieron  con recirculación, aireación y temperatura promedio de 23°C; la alimentación se calculó con base a la biomasa de los animales. Al final del experimento, de cada tratamiento se sacrificaron al azar dos animales, para evaluar conteo de coliformes totales y fecales, hongos y levaduras, cocos gram positivos y <em>Vibrio</em> sp en muestras de canal, piel e intestino de ambos tratamientos. Para los análisis zootécnicos, se pesaron y midieron todos los animales de cada tratamiento, calculando conversión alimenticia (CA), tasa de crecimiento específico (TCE), ganancia de peso (GP), ganancia de talla (GT) y % sobrevivencia. <strong>Resultados</strong>: No se detectó presencia de <em>Vibrio</em> sp, ni hongos. Se encontraron diferencias estadísticamente significativas p&lt;0,05 en el conteo de coliformes  y mesófilos en las estructuras evaluadas en los peces. Los peces suplementados con probióticos presentaron un recuento de UFC de coliformes y mesofilos menor que en los no suplementados.  La población de cocos Gram positivos y levaduras no mostró diferencias estadísticamente significativas entre los tratamientos p&gt;0,05.  El estudio también permitió asegurar que bajo las condiciones experimentales, los peces que consumieron la dieta con probióticos mostraron diferencias estadísticamente significativas p&lt;0,05 en todos los parámetros zootécnicos evaluados. <strong>Conclusión</strong>: Se evidenció que la inclusión de 1% de probióticos micro-encapsulados adicionados a la dieta de tilapia roja, mejora las condiciones zootecnias de los animales y a su vez promueve la inocuidad de los mismos.</p><p><strong>Palabras clave:</strong> Coliformes, mesófilos, microencapsulación </p><p align="center"><strong>SAFETY ASSESSMENT AND ZOOTECHNICAL PARAMETERS IN TILAPIA (<em>Oreochromis </em>sp) SUPPLEMENTED WITH PROBIOTICS</strong></p><p align="center"> </p> Eliana M. Betancur-González ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2911 Tue, 06 Dec 2016 20:36:03 -0500 DIAGNÓSTICO PRODUCTIVO Y CARACTERIZACIÓN DE PRODUCTORES DE TRUCHA ARCOÍRIS EN POTOSÍ, CÓRDOBA, CUMBAL Y PASTO http://revistas.udenar.edu.co/index.php/revip/article/view/2916 <p>El estudio caracterizó las condiciones de producción y productivas de truchifactorías de los municipios de Potosí, Córdoba, Cumbal y Pasto (El Encano), a través de visitas, encuestas y talleres con posterior evaluación y análisis de datos cuantitativos, asociación entre variables y determinación de relación causal entre ellas. La infraestructura de los proyectos, poseen caudal autorizado promedio 19 L.s<sup>-1</sup>; área de espejo de agua 602 m<sup>2</sup> y finca en producción 80 m<sup>2</sup> con 8 estanques promedio por municipio. Entre los parámetros productivos están 24 toneladas.año<sup>-1</sup>, cosechas en ciclos de 8 meses; peso inicial promedio 4,4g y peso máximo a mercado500 gramos, 87,6 toneladas de alimento concentrado, definiendo así, una tasa de conversión alimenticia promedio 1,5.</p><p>En fase de alevinaje, la semilla sembrada (1x10<sup>6</sup> animales) en caudal promedio 12,5 L.s<sup>-1</sup>; sobrevivencia promedio 81% y conversión alimenticia máxima 1,8. Alteraciones del agua, fallas humanas y robo, son causas de baja producción en Potosí; actividades cotidianas (Normal) en Córdoba y Cumbal; parasitosis y efectos climáticos en Cumbal y Potosí. Como fármaco, la sal marina útil en Potosí (60%); antibióticos (60%), Azul de Metileno (62%) y Verde de Malaquita (aplicación autónoma no autorizada) aplica Cumbal (100%).</p><p>En levante, 2281 ejemplares analizados, caudal máximo 10 L.s<sup>-1</sup>; sobrevivencia 83%; conversión alimenticia máxima 1,8. El estado sanitario <em>Bueno</em> en proyectos de Cumbal (50%); estado <em>Normal </em>en Potosí (67%), estado <em>Regular</em> Cumbal (100%). Alteraciones del agua y Fallas Humanas causan disminución en Potosí (100%); actividades Normales en Potosí, Córdoba y Cumbal (33,3%); Enfermedades parasitarias y Alteraciones climáticas en Cumbal (64%). Antibióticos, Azul de Metileno y Verde de Malaquita utilizados en Cumbal (100%) y sal marina en Potosí (57%).</p><p>En engorde, 2085 ejemplares sembrados en caudal 10 L.s<sup>-1</sup>; sobrevivencia promedio 93%; conversión alimenticia máxima 1,8. El estado sanitario <em>Bueno</em> en proyectos de Cumbal y Potosí (44%); condición <em>Normal </em>en Potosí (50%), <em>Regular</em> sanidad en Cumbal (100%). Alteraciones de agua y robo de productos en Potosí (100%); actividades <em>Normales</em> en Cumbal (50%); parasitosis y efectos climáticos en Cumbal (64%) y alteraciones del agua y fallas humanas en Potosí (100%). Verde de Malaquita (100%), Azul de Metileno (75%) y los antibióticos en Cumbal; sal marina en la actividad de Potosí (70%).</p><p>Los kilogramos.año<sup>-1</sup> producidos, no difieren estadísticamente, la mayor media en Córdoba 5,6 tn.año<sup>-1</sup>; por fase, engorde 3,2 tn.año<sup>-1</sup>; tipo de concentrado, Solla® (12,2 tn.año<sup>-1</sup>). La conversión alimenticia difiere con Solla® (2,4); sin diferencias entre municipios (Potosí 1,6) e igual entre fases (engorde 1,55). El estado sanitario <em>Regular</em> es significativo al control <em>Normal</em>; sin diferencias, actúan enfermedades bacterianas y alteraciones del agua y en fármacos el Metileno interfieren en mayor media. </p><p><strong>Palabras clave:</strong> red horizontal, red vertical, partes interesadas, asociatividad, unidad articuladora </p><p align="center"><strong>PRODUCTIVE DIAGNOSIS AND CHARACTERIZATION OF PRODUCERS OF RAINBOW TROUT OF POTOSI, CÓRDOBA, CUMBAL AND PASTO</strong></p> Julbrinner Salas-Benavides ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2916 Tue, 06 Dec 2016 20:36:03 -0500 PERCEPCIONES ORGANIZACIONALES Y PREDISPOSICIÓN ASOCIATIVA DE PISCICULTORES DE TRUCHA DE CUMBAL Y POTOSÍ DE NARIÑO http://revistas.udenar.edu.co/index.php/revip/article/view/2917 <p><strong>Introducción. </strong>En Colombia<strong>, </strong>Los municipios de Cumbal y Potosí del Departamento de Nariño albergan una significativa población dedicada a la producción y comercialización de trucha Arco Iris, no obstante, su producción es poca, su estructura orgánica es de famiempresa, el manejo técnico del producto es artesanal y su mercadeo es local. Son pequeños productores que necesitan urgentemente procesos de asociatividad y capacitación en procesos técnicos del manejo de la trucha, orientación específica en aspectos administrativos, contables, financieros, tributarios, tecnológicos y de mercadeo para así poder cambiar su dinámica organizacional y tornarlos más competitivos. <strong>Objetivo.</strong> Determinar las percepciones organizacionales y predisposición asociativa de los pequeños productores de trucha de Cumbal y Potosí. <strong>Métodos.</strong> La investigación es no experimental transaccional, el estudio es descriptivo explicativo, analiza la predisposición en torno a la asociatividad y percepciones del negocio, se explica las interacciones, causas y efectos de su estado actual de desarrollo. Se utilizó la encuesta sobre factores de predisposición hacia la asociatividad, análisis matricial, taller y entrevista a grupo focal. Para tratamiento de datos cuantitativos se utilizó spss versión 21 y en datos cualitativos se trabajó por vaciado de la información, proposiciones agrupadas, obtención de categorías inductivas.<strong> Resultados</strong>. En factores de predisposición hacia la asociatividad hay mucha desconfianza debido a falsas promesas políticas, uso de nombres para proyectos ajenos a su realidad y promesas incumplidas; en cuanto al compromiso no hay trabajo en equipo, se piensa en intereses particulares, no hay visión ni sentido asociativo, tienen muchas dudas y desconocimiento en el manejo técnico del producto, no hay bases administrativas, contables, y financieras. En el aspecto tecnológico la producción es artesanal y desconocen nuevas formas de producción y comercialización, se piensa en vender el producto sin análisis de costos, los beneficios económicos del negocio son mínimos y cortoplacistas. En cuanto a la necesidad e interés por asociarse cerca del 90 por ciento están dispuestos a asociarse pues ven en ello una oportunidad de aumentar su productividad, acceder a clientes externos, mejorar la calidad del producto, adquirir mayor visibilidad en el entorno competitivo. En lo que respecta a sus percepciones sobre su estructura organizacional hay unidades piscícolas que están trabajadas por una sola persona o por una o dos familias, están agrupados algunas en asociaciones pequeñas pero no representativas ni con imagen corporativa, son conscientes de que es necesario adquirir una estructura formal y legalidad de su negocio; no hay procesos administrativos claros, tampoco hay planeación, control y manejo contable y financiero, el capital de inversión es mínimo, no tienen capacidad de endeudamiento, requieren urgentemente asociarse y mejorar sus condiciones de producción, administración y mercadeo para ser más competitivos y lograr sostenibilidad en el mercado.  <strong>Conclusión.</strong>  Las percepciones organizacionales de los pequeños productores de trucha de Cumbal y Potosí derivan de su experiencia personal, no es técnica ni académica, por lo que desconocen procesos administrativos, contables, financieros y de mercadeo; temen constituirse legalmente como empresa, ven el cultivo de trucha como fuente de ingresos no como una oportunidad de negocio derivada de capacidades de emprendimiento. En lo concerniente a la predisposición asociativa, hay mucha desconfianza, escaso compromiso, poco dominio del proceso productivo de la trucha, poco liderazgo, dificultades en proceso comunicativos, hay deficiente manejo de tecnología,  sin embargo ven la necesidad de asociarse y trabajar en equipo para ser más productivos y competitivos en el sector piscícola a nivel local, regional y nacional.</p><p><strong>Palabras clave:</strong> Asociatividad, piscicultores, confianza, compromiso, conocimiento, ingresos.</p><p align="center"><strong>ORGANIZATIONAL PERCEPTIONS AND WILLINGNESS ASSOCIATIONS OF FISH FARMERS OF TROUT OF CUMBAL AND POTOSI OF NARIÑO</strong></p> Alvaro J. Belalcazar-Belalcazar ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2917 Tue, 06 Dec 2016 20:36:03 -0500 ADICIÓN DE NITRITO DE SODIO AL INICIO DEL BIOFLOC http://revistas.udenar.edu.co/index.php/revip/article/view/2918 <p><strong>Introducción:</strong> la tecnología Biofloc-BFT se sustenta en el desarrollo de microorganismos que favorecen esencialmente el reciclaje del nitrógeno disuelto en el agua causado por excreción de los peces y alimento no consumido, con la adición de una fuente de carbono, alta oxigenación y bajo recambio de agua; la información de cómo iniciar  el sistema es escasa, sin embargo la estabilización podría ser determinada por los niveles del nitrógeno amoniacal total, nitritos y nitratos,  bajo una baja fluctuación de parámetros como el pH, temperatura, salinidad, alcalinidad, dureza, CO<sub>2 </sub>y solidos como los más relevantes, observándose procesos de nitrificación, en este sentido el Objetivo fue: evaluar la adición de Nitrito de sodio (NaNO2) como coadyuvante en los procesos de nitrificación al iniciar un sistema con BFT. <strong>Métodos</strong>: el experimento se desarrolló en el Instituto de acuicultura de los Llanos en la ciudad de Villavicencio-Colombia, se emplearon 9 tanques con volumen de 500 litros y sistema de aireación tipo blower, para el inicio del sistema fue tenido en cuenta las recomendaciones descritas por De Schryver et al. (2008) a una relación C:N = 20:1, como fuente de carbono se empleó melaza (% de C del 40), para estabilización de alcalinidad  carbonato de calcio, salinidad con NaCl (2,5 g*L-1); se evaluaron dos tratamientos de adición a partir del cuarto día con nitrito de sodio a una concentración de 1mg/L y 2mg/L y un tercer tratamiento control sin adición, se midió Amonio total, nitrito y nitrato por colorimetría durante 12 días, temperatura, pH, oxigeno con multiparametro y alcalinidad por titulación. <strong>Resultados</strong>: los tres tratamientos presentaron las siguientes condiciones: OD &gt; 5,7 mg/L; %S &gt; 64; pH ≈ 7,8; T° = 24°C; alcalinidad &gt;120 mg/L; de los compuestos nitrogenados los tres tratamientos presentaron las curvas típicas de maduración del sistema, un incremento del nivel de NAT a partir del día cuarto con picos máximos en el día 14 (tto 1 y 3 = 10 mg/L, Tto 2 = 15 mg/L) y un descenso llegando a limites cercanos a 0 hacia el día 20 , los NO<sub>2 </sub>para el Tto 1 se observan a partir del día 15, Tto 2 día nueve y Tto 3 día 16, con picos máximos en los días 17 (≈ 5 mg/L) y una reducción a partir del día 18 sin llegar a 0, para el caso del NO<sub>3 </sub>se observaron a partir del día 14 en los Ttos 1 y 2 y el día 15 en el Tto 3, sin embargo el TTo 1 indica mayores niveles y estabilización desde el día 15 llegando a concentraciones ≤ 116 mg/L en el día 17 y sin mayores fluctuaciones comparándolo con el resto de tratamientos. <strong>Conclusión:</strong> el tratamiento que mostró estabilización más rápida fue T1 (1mg/L de nitrito de sodio)</p><p><strong>Palabras clave: </strong>biofloc, nitrificación, bacterias, amonio. </p><p align="center"><strong>ADDITION OF SODIUM NITRITE THE BEGINNING OF THE BIOFLOC</strong></p> Luis F. Collazos-Lasso ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2918 Tue, 06 Dec 2016 20:36:03 -0500 Moina minuta Y Macrothrix elegans COMO PRESAS EN LA PRIMERA ALIMENTACIÓN DE DORADA Brycon sinuensis http://revistas.udenar.edu.co/index.php/revip/article/view/2914 <p><strong>Introducción</strong>. La dorada <em>Brycon sinuensis</em> es una especie omnívora con potencial para la piscicultura continental que presenta conducta caníbal al inicio de la alimentación exógena; este comportamiento ocasiona bajas tasas de sobrevivencia y heterogeneidad en el tamaño de las larvas. El uso de larvas forrajeras de interés comercial en el manejo de primera alimentación, ha permitido el avance en su manejo; no obstante, producir larvas de tan preciado valor económico con fines de forraje genera un aumento en los costos operativos en acuicultura. Una posible alternativa, no evaluada hasta el momento, es el uso de cladóceros seleccionados y cultivados masivamente. <strong>Objetivo</strong>. Evaluar diferentes presas vivas en el manejo de primera alimentación de <em>B. sinuensis</em>. <strong>Métodos</strong>. En el Instituto de Investigación Piscícola de la Universidad de Córdoba (CINPIC) se realizó la larvicultura de <em>B. sinuensis</em>. Al inicio de la alimentación exógena se suministró como presas vivas por una sola vez, durante 24 horas, larvas recién eclosionadas de <em>Piaractus brachypomus</em> en proporción 2:1 presa-predador (Pb); en densidad de 20 organismos/ml<em> </em>fueron ofrecidos los cladóceros<em> Moina</em> <em>minuta</em> (Mo); <em>Macrothrix</em> <em>elegans</em> (Ma)  y la mezcla en proporción 50:50 de <em>Moina</em> <em>minuta </em>+ <em>Macrothrix</em> <em>elegans</em> (MM). Bajo un diseño totalmente al azar con cuatro réplicas por tratamiento se instalaron un total de16 acuarios con volumen útil de cinco litros. Un total de 4000 larvas fueron evaluadas a densidad de 50 larvas/L. Las variables de desempeño como ganancia en peso (Gp), ganancia en longitud (Gl), tasa de crecimiento específico (G), sobrevivencia (S), mortalidad por canibalismo (Mc) y resistencia al estrés (Re) fueron determinadas en el manejo de la primera alimentación. <strong>Resultados</strong>. Larvas alimentadas con Mo exhibieron la mayor sobrevivencia (76,1±6,61%) y la menor mortalidad por canibalismo (16,8±3,75%) con diferencia significativa con los demás tratamientos (p&lt;0,05). La resistencia al estrés osciló entre 92,5±5,0% y 95,3±2,37% en larvas alimentadas con Ma y Mo respectivamente sin diferencia significativa entre los tratamientos (p&gt;0,05). Las larvas alimentadas con Pb presentaron mayor Gp (1,49±0,37 mg), Gl (1,63±0,13 mm) y G (3,15±0,43%/h). <strong>Conclusión</strong>. El uso de los cladóceros <em>Moina</em> <em>minuta </em>y <em>Macrothrix</em> <em>elegans</em> producidos bajo condiciones controladas, permitió alta sobrevivencia, adecuados desempeño y resistencia al estrés de las larvas de dorada, como presa viva viable para manejo de la primera alimentación de <em>B. sinuensis</em>.</p><p><strong>Palabras clave:</strong> alimento vivo, cladóceros, larvicultura</p><p align="center"><strong><em>Moina</em></strong><strong> <em>minuta</em>  AND <em>Macrothrix elegans</em>  AS PREY FOR FIRST FEEDING OF DORADA <em>Brycon sinuensis</em></strong></p> Martha Janeth Prieto Guevara ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2914 Tue, 06 Dec 2016 20:36:03 -0500 HABITOS ALIMENTARIOS DE LA PELADA YANCA (Cynoscion phoxocephalus) EN LA ZONA BUENAVENTURA, COLOMBIA. http://revistas.udenar.edu.co/index.php/revip/article/view/2915 <p><strong>Introducción</strong>. La especie <em>Cynoscion phoxocephalus</em> es la especie de corvina, más abundante en la región del Pacífico Colombiano, se ha reportado estudios de identificación, censos poblacionales referentes de las capturas artesanales e industrial como mecanismo de conocer los volúmenes de pesca y su importancia en el consumo local y nacional. Más sin embargo, al ser la pesca una actividad extractiva puede afectar las existencias de la población y las acciones tendientes a mantener un equilibrio poblacional, para lo cual se requieren estudios específicos que demuestre la determinación de los hábitos alimenticios tendientes a establecer los requerimientos nutricionales de la especie e indispensable en el proceso de cría en cautiverio, reproducción para repoblamiento y establecerse como cultivo en el Pacífico Colombiano. <strong>Objetivo</strong>. Identificar hábitos alimenticios de la Pelada Yanca o corvina.  <strong>Métodos</strong>. El estudio se realizó en la zona del corregimiento de Punta Soldado la cual está ubicada a 15 kilómetros de la Bahía de Buenaventura, con coordenadas  03° 48´30´´N y 77° 10´ 52 O. Se establecieron los datos biométricos, trofodinámicos y análisis bromatológico  de la presa durante los periodos comprendidos en el año 2013 hasta  el año 2015.  <strong>Resultados</strong>. Los peces se capturaron por los pescadores artesanales, de la población total se tomó unas muestras de 890 de los cuales 280 fueron machos; 610 hembras; Machos 34±7,34 DS cm y hembras tuvieron 35, 8 ±4,89 DS cm la longitud total promedio; la longitud estándar fue de 29±1,2 DS cm en machos y hembras 32,11 ±7,5 DS cm; 345 g fue el peso total macho; 389 g fue el peso total hembra; Peso eviscerado machos fue 307 g;  y peso eviscerado hembras 341 g. Posteriormente se pesó el tracto gastrointestinal y se verifico la presencia de presas en el estómago. Se encontró que la mayoría de los estómagos estuvieron vacíos (81%). En el 19% de estómagos se encontró con el análisis cuantitativo del espectro trófico, a través de los  métodos cuantitativos como el método numérico (N% :98 que corresponde  a peces y el resto camarón el 12%), método gravimétrico 78% corresponde a peces y 22% que pertenece al camarón y método de frecuencia de aparición FA% corresponde a peces la principal presa encontrada con un 41,2% del total y el segunda corresponde a  12,4%  a camarón. Con el análisis bromatológico de las presas se estableció que 51,08% de proteína, y 5389 Cal/g de energía bruta.  <strong>Conclusión</strong>. Los resultados indican que la principal presa de consumo es el pez carduma <em>(Cetengraulis mysticetus),</em> y algunas presas de la especie de camarón, esto confirma el hábito carnívoro de la especie. Los requerimientos proximales en la nutrición de <em>C. Phoxocephalus</em> con un requerimiento que se demuestra con él análisis nutricional de la muestra de contenido estomacal.</p><p><strong>Palabras claves:</strong> presa, dieta, Pez, Sciaenidae</p><p align="center"><strong>FEEDING HABITS OF PELADA YANCA (C<em>ynoscion phoxocephalus</em>) IN THE AREA BUENAVENTURA, COLOMBIA</strong></p><p align="center"> </p> Olga Rosero ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2915 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DE FUENTES DE PROTEÍNA EN EL DESEMPEÑO PRODUCTIVO DE Piaractus brachypomus EN BIOFLOC http://revistas.udenar.edu.co/index.php/revip/article/view/2919 <p><strong>Introducción. </strong>Los cultivos en biofloc (BFT) son sistemas con mayor interés con relación a los convencionales por aspectos determinantes como son las mayores capacidades de carga, menor uso de agua y mayor bioseguridad para el animal. BFT presenta muchas características especiales entre ellas su aporte de proteína bacteriana que es aprovechada por los peces. En razón a lo anterior, la pregunta es si puede ser ofrecido un alimento con baja cantidad de proteína de diferentes fuentes. <strong>Objetivo. </strong>Determinar el desempeño productivo de la cachama blanca en un sistema BFT alimentadas con dietas experimentales con diferentes fuentes de proteína.<strong> Método</strong>. Para la evaluación fueron empleados tres tratamientos: T1: BFT + alimento del 24% de Proteína cruda (PC) de origen vegetal; T2: BFT+ alimento del 24% de PC con 5% de Harina de pescado; T3: BFT + alimento del 24% de PC con 5% de harina de espirulina, los peces fueron alimentados tres veces al día hasta saciedad aparente y el biofloc se mantuvo una relación C:N de 15:1, sombrío del 80% y coloración marrón. Cada tratamiento tuvo tres replicas para un total de nueve unidades experimentales, contenida cada una en un tanque de 500 L, en cada tanque se sembraron 42 peces (54,5±5,8 g) y se cultivaron durante 84 días. El sistema se operó con aireación por blower y temperatura constante. Para la obtención de los parámetros productivos se registró el consumo de alimento restando los rechazos diariamente, se tomaron medidas periódicas de longitud total (LT) y peso en gramos (P) y se determinaron los parámetros de supervivencia (S), conversión alimenticia (FCA), biomasa (BIO Kg/m<sup>3</sup>), ganancia diaria de peso (GDP, g/día), tasa especifica de crecimiento (TEC, %/día) y factor de condición (K). <strong>Resultados</strong>. La BIO fue de 15,8 ± 0,39 Kg/m<sup>3</sup>, 15,3 ± 0,1 kg/m<sup>3</sup> y 15,5 ± 0,6 kg/m<sup>3</sup> en T1, T2 y T3 respectivamente. La GDP fue de 1,83 ± 0,71 g/día; 1,62 ± 0,68 g/día y 1,65±0,70 g/día de T1, T2 y T3 respectivamente. La FCA fue 1,05 ± 0,13; 1,09 ± 0,09 y 1,02 ± 0,11 para T1, T2 y T3 respectivamente; cuando se evaluaron estadísticamente los parámetros a P&gt;0,05 no se encontraron diferencias significativas entre los tratamientos. La supervivencia fue del 100% en todos los casos.<strong> Conclusión</strong>. La fuente de proteína utilizada en las dietas no afectó los parámetros de desempeño productivo de Cachama blanca en BFT.</p><p><strong>Palabras clave</strong>: espirulina, harina de pescado, proteína vegetal, Cachama blanca</p><p><strong>EVALUATION OF SOURCES OF PROTEIN IN THE PRODUCTIVE PERFORMANCE IN <em>Piaractus brachypomus</em> IN BIOFLOC</strong></p> Hernán Antonio Alzate-Díaz ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2919 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DEL CRECIMIENTO EN CANGREJO AZUL Cardisoma crassum USANDO ALIMENTO COMERCIAL http://revistas.udenar.edu.co/index.php/revip/article/view/2920 <p><strong>Introducción.</strong> El Cangrejo Azul (<em>Cardisoma crassum</em>) es un recurso hidrobiológico con importancia ecológica y económica. Su rol ecológico en los ecosistemas es la rotación de los suelos mediante la remoción de la materia orgánica cuando la utiliza como fuente de alimento. Esta acción permite la aireación de los fondos y evacuación de gases producto de procesos fermentativos en los suelos. La importancia económica radica en la cadena de valor comercial que inicia con la extracción del organismo en el medio por parte de los habitantes ribereños de los ríos, quienes derivan gran parte de su sustento de la extracción de este y otros crustáceos, además de moluscos, la pesca y madera. <strong>Objetivo.</strong> Evaluar el crecimiento del cangrejo azul sometido a tres dietas alimenticias con diferente nivel de contenido proteico. <strong>Métodos.</strong> Para las unidades experimentales se emplearon cangrejos  obtenidos del medio natural, confinados a una densidad de 32 cangrejos/m<sup>2</sup> en contenedores impermeabilizados en su interior con pintura epóxica negra para oscurecer el ambiente, instalados de forma inclinada al 4% para generar un reservorio de agua concibiendo un lado húmedo para el remojo de las branquias y un lado seco para el suministro del balanceado. Los especímenes fueron estabulados por un tiempo de 65 días. Se utilizaron tres tratamientos de contenido proteico: T<sub>1</sub>: 24%, T<sub>2</sub>: 30% y T<sub>3</sub>: 40%. Se alimentó a saciedad manteniendo disponibilidad de alimento todo el tiempo, empleando balanceado comercial (Italcol®), se realizaron biometrías de peso del organismo, medidas del caparazón (largo, ancho y alto), cada 20 días Las unidades y los tratamientos fueron ubicados en un diseño experimental con una distribución completamente al azar. Para establecer si existían diferencias estadísticamente entre los tratamientos se utilizó un ANOVA al 95% de sensibilidad. .<strong>Resultados.</strong> Se observó una ganancia en peso de algunos cangrejos en todos los tratamientos, producto de la retención de nutrientes que se acumulan en el hepatopáncreas antes del proceso de muda y que luego son transformados en biomasa. No se tuvo procesos de muda en ninguno de los cangrejos en cada tratamiento. <strong>Conclusión.</strong> El crecimiento (incremento en el peso y aumento en el tamaño) no presento diferencias estadísticamente significativas respecto de los porcentajes de proteína utilizados, Se determinó la viabilidad en el cultivo del cangrejo azul empleando alimentos concentrados comerciales, se recomienda el empleo de balanceado con un 24% de proteína de más bajo costo.</p><p><strong>Palabras clave:</strong> <em>Gecarcinidae, </em>cultivo, crustáceos<em>,</em> dieta</p><p align="center"><strong>EVALUATION OF GROWTH OF BLUE CRAB <em>Cardisoma crassum</em> USING COMMERCIAL FOOD</strong><strong></strong></p> Pedro A. Tabres-Beron ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2920 Tue, 06 Dec 2016 20:36:03 -0500 SUSTITUCION DE HARINA DE PESCADO POR SUBPRODUCTOS AVICOLAS EN ETAPA INICIAL DE CULTIVO DE CACHAMA http://revistas.udenar.edu.co/index.php/revip/article/view/2921 <p><strong>Introducción. </strong>El 60% de los costos de producción de peces cultivados son generados por la alimentación, especialmente por el elevado precio de la harina de pescado, la cual se utiliza como principal fuente de proteína. Así, se hace necesario buscar fuentes proteicas con alto valor nutricional que sean de bajo costo, disponibles, producidas de manera sostenible y que no sea utilizada para alimentación humana. La harina de subproductos avícolas (HSA) se convierte en una materia prima alternativa, que contiene un nivel de proteína entre el 58 y 62%, lípidos de 12 a 15%, cenizas de 18 a 23%, siendo una buena fuente de lisina y metionina; en la actualidad la HSA es comercializada industrialmente y su precio es menor al de la harina de pescado. <strong>Objetivo.</strong> Determinar el potencial de la harina de subproductos avícolas como substituto de la harina de pescado en dietas para cachama blanca <em>Piaractus brachypomus,</em> en la etapa inicial de cultivo. <strong>Métodos.</strong> El trabajo se realizó en la Unidad Productiva del Centro Agroindustrial del Meta sede Hachón (SENA) y<strong> </strong>en el Instituto Acuicultura de los Llanos (IALL) en el Laboratorio Experimental de Alimentación y Nutrición de Peces (LEANP), Villavicencio, Meta – Colombia. Para evaluar el desempeño zootécnico se emplearon 972 alevinos de cachama blanca<strong><em> </em></strong>obtenidos mediante reproducción inducida, con peso de 22,61±4,12 g, distribuyéndolos aleatoriamente en nueve estanques (3 tratamientos, 3 réplicas) de 36 m<sup>3 </sup>(5 m x 9 m x 0,8 m), manejando una densidad de 3 peces/m<sup>3</sup>. Se elaboraron tres dietas en las que se substituyó 0, 50 y 100% de la harina de pescado por harina de subproductos avícolas; las dietas fueron isoproteicas (36% PB) e isoenergéticas (4334 cal/g). Los peces fueron alimentados durante 41 días, 2 veces al día, hasta aparente saciedad. Los parámetros estudiados fueron ganancia de peso, tasa de conversión alimenticia (FCR), tasa de crecimiento específico (SGR), tasa de eficiencia proteica (PER) y sobrevivencia. Los datos obtenidos fueron expresados como media y sometidos a análisis de varianza (ANOVA) (p&lt;0,05). Las medias se compararon por test de Tukey. <strong>Resultados. </strong>No hubo diferencias significativas entre tratamientos. La ganancia de peso fue para los tratamientos 1, 2 y 3: 33,7±7,2 g, 27,6±5,4 g y 28±1,9 g.; FCR:<ins cite="mailto:Adriana%20Mu%C3%B1oz" datetime="2016-09-19T11:18"> </ins>2,7±1,5, 2,2±0,7 y 2,6±0,8, SGR: 2,2±0,4, 1,8±0,4 y 2,1±0,3; PER: 1,2±0,4, 1,4±0,4 y 1,2±0,3; sobrevivencia 99,7%, 100% y 100%, respectivamente. <strong>Conclusiones. </strong>Estos resultados muestran que se puede reemplazar hasta un 100% la harina de pescado por harina de subproductos avícolas (HSA) sin efectos negativos sobre los parámetros zootécnicos en la etapa inicial de cachama blanca.</p><p><strong>Palabras claves:</strong> alimentación, nutrición, <em>Piaractus brachypomus</em></p><p align="center"><strong>REPLACEMENT OF FISH MEAL BY POULTRY BYPRODUCT MEAL ON GROWTH INITIAL STAGE OF WHITE CACHAMA</strong></p><p><em><br /></em></p> Carlos Alberto Perez-Sepulveda ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2921 Tue, 06 Dec 2016 20:36:03 -0500 PARÁMETROS DE QUÍMICA SANGUÍNEA DE CACHAMA BLANCA ALIMENTADA CON UNA DIETA EXPERIMENTAL. http://revistas.udenar.edu.co/index.php/revip/article/view/2922 <p><strong>Introducción. </strong>Las variables plasmáticas de glucosa, proteína, triglicéridos y colesterol son parámetros indicadores del estado sanitario de las poblaciones naturales y permiten evaluar el manejo dietario en cautiverio; dependiendo de la concentración de estos nutrientes en la sangre se ve influenciada la velocidad en la que son utilizados para los requerimientos metabólicos esenciales y su depósito en diferentes tejidos. <strong>Objetivo.</strong> Determinar parámetros de química sanguínea de <em>Piaractus brachypomus,</em> cachama blanca, en respuesta a una dieta del 36% de proteína bruta. <strong>Métodos.</strong> El estudio se llevó a cabo en el Instituto Acuicultura de los Llanos (IALL) en el Laboratorio Experimental de Alimentación y Nutrición de Peces (LEANP), Villavicencio, Meta – Colombia. Se seleccionaron 90 alevinos de cachama blanca, obtenidos mediante reproducción inducida, con peso de 1,6±0,4 g, posteriormente fueron ubicados en 3 tanques de 60 L de capacidad (30 individuos/tanque). Los peces fueron alimentados 7 días a la semana, dos veces al día, hasta aparente saciedad, con una dieta de 36% de proteína bruta y 4214 kcal/kg de energía bruta. En el día 30 los peces fueron anestesiados, para posteriormente tomar las muestras de sangre, por punción de la vena caudal con jeringas que contenían el anticoagulante heparina, para determinar los niveles de glucosa, colesterol, triglicéridos y proteína en plasma. <strong>Resultados.</strong> El peso final fue 10,3±2,1 g; ganancia de peso (%): 546,3±133,9. Las variables plasmáticas obtenidas fueron para glucosa 92,2±13,3 mg/dL, proteína 1,52±0,16 g/dL, triglicéridos 50,1±20,1 mg/dL y colesterol 76,6±8,3 mg/dL. <strong>Conclusiones. </strong>Los resultados obtenidos de los análisis de química sanguínea al ser comparados con los rangos que se reportan en la literatura para esta especie, se encuentran dentro de los valores considerados como normales, a excepción de los triglicéridos, mostrándose disminuidos 100 mg/dL. Esta alteración puede ser explicada por la utilización del anticoagulante en la toma de la muestra sanguínea, siendo un glicosaminoglicano que funciona como activador de la enzima lipoproteína lipasa encargada de la hidrólisis de los triglicéridos.</p><p><strong>Palabras claves:</strong> Alimentación, glucosa, nutrición, proteína, sangre</p><p><strong>PARAMETERS BLOOD CHEMISTRY of cachama WHITE feed dietary experimental</strong></p> Laura K. Bohorquez-Medina ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2922 Tue, 06 Dec 2016 20:36:03 -0500 IDENTIFICACIÓN DE ÍTEMS ALIMENTICIOS DE Brycon henni LOCALIZADOS EN LA CUENCA BAJA DEL RÍO SABALETAS-BUENAVENTURA http://revistas.udenar.edu.co/index.php/revip/article/view/2923 <p><strong>Introducción.</strong><em> Brycon  henni </em>es uno de los peces de mayor demanda para el consumo por parte de las comunidades afrodescendientes asentadas en las riberas del río Sabaletas. Sin embargo, la disponibilidad  de esta especie ha disminuido por causas tanto antrópicas como medioambientales. En el marco del proyecto, “EVALUACIÓN DE LA CALIDAD NUTRICIONAL DE MATERIAS PRIMAS ALTERNATIVAS, PARA SU INCLUSIÓN EN SUPLEMENTO ALIMENTICIO DE ESPECIES DE PECES NATIVOS EN EL CONSEJO COMUNITARIO DE SABALETAS, BUENAVENTURA–VALLE DEL CAUCA, COLOMBIA”, bajo el convenio de cooperación interinstitucional entre Fundación EPSA y la Universidad Nacional de Colombia Sede Palmira – Facultad de Ciencias Agropecuaria, desarrollando actividades que permitieron identificar los ítems alimentarios de la especie en esta zona. <strong>Objetivos. </strong>Identificar los ítems alimenticios de <em>B. henni </em>en la parte baja del río Sabaletas. <strong>Métodos. </strong>Los especímenes fueron comprados a los pescadores de la zona; en campo se conservó el material biológico en alcohol al 96%, durante la fase de laboratorio los ejemplares fueron eviscerados para extraer los estómagos, registrando el peso lleno (PLl) y el peso vacío (PVa); el contenido estomacal se clasificó en tres categorías: material Vegetal, Animal y Desconocido y se identificó los diferentes ítems alimentarios. Finalmente se estimó la frecuencia de aparición en porcentaje (%FA),  se cuantificó la biomasa por peso (P) y se estableció el Índice de Importancia Relativa (IIR); los análisis se realizaron para los tres tipos de materiales y para los ítems alimentarios. <strong>Resultados. </strong>De los estómagos analizados por tipo de material, Animal, Vegetal y Desconocido  se obtuvo un %FA del  54.29, 28.57 y 17.14 respectivamente,  en cuanto a P se obtuvo un porcentaje de 58.6, 35.05 y 6.37 de igual manera los valores para IIR 74.33, 24.13 y 2.54. En todos los estómagos se encontró material Animal, principalmente restos de hormigas (IIR: 41.4%). Se identificaron 9 Ítems alimentarios diferentes.  <em>B. henni </em>posee comportamiento alimentario generalista con tendencia a preferir presas de origen animal.  De acuerdo con los resultados obtenidos se observa que hay similitud con otros estudios realizados en especies de comportamiento alimentario similar. <strong>Conclusión.</strong> <em>B. henni </em>es una especie que presenta una dieta omnívora donde la mayor proporción está dominada por material animal y una menor proporción conformada por material vegetal. Teniendo en cuenta el tipo de alimentos encontrados en los estómagos de <em>B. henni </em>y dadas las características medioambientales y biológicas del Pacífico Colombiano se propone evaluar la utilización e inclusión de material vegetal afectado por insectos como alternativa  para la alimentación de esta especie nativa.</p><p> <strong>Palabras clave: </strong><em>Brycon henni</em>, Pacífico, alimentación animal, Seguridad alimentaria, Conservación </p><p align="center"><strong>FOOD ITEMS IDENTIFICATION OF <em>Brycon henni </em>LOCATED<em> </em>IN LOWER BASIN RIVER SABALETAS-BUENAVENTURA</strong></p> A. Domínguez-Ramírez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2923 Tue, 06 Dec 2016 20:36:03 -0500 RESPUESTA REPRODUCTIVA A DOS DIETAS DIFERENTES EN Mykrogeophagus ramirezi var. Blue http://revistas.udenar.edu.co/index.php/revip/article/view/2925 <p><strong>Introducción.</strong> Ramira o ramirezi es sin duda uno de los más vistosos y populares peces de acuario suramericanos. La reproducción es relativamente sencilla y se da espontanea en contenedores apropiados con calidad de agua adecuada. Todas las variedades del mercado son criadas en acuario siendo la variedad azul la que mayor dificultad y menor productividad exhibe, siendo ello atribuido en parte al régimen alimenticio al que son sometidos los reproductores. <strong>Objetivo.</strong> Analizar el uso de dos dietas en la reproducción de <em>M. ramirezi</em>. <strong>Métodos.</strong> Para comparar el desempeño reproductivo se realizó un experimento de dos meses en acuarios de 20 L (7 L útiles), densamente poblados con cuba <em>Ludwigia inclinata</em>, elodea (<a title="Elodea canadensis" href="https://es.wikipedia.org/wiki/Elodea_canadensis"><em>Elodea canadensis</em></a><em>) y buchón de agua</em><em> (Eichhornia crassipes), </em>con dos tratamientos y tres replicas por tratamiento, consistentes en: tratamiento 1. T1, ración para peces del 32% de proteína bruta, tratamiento 2. T2, zooplancton silvestre (Daphnia 10%, Mohina 5%, Ceriodaphnia 5%, y Copépodos 60%). Los reproductores experimentados fueron peces adultos de cinco meses de vida y 4,3 ± 0,4 cm de longitud estándar colocados en parejas al azar (seis parejas), que fueron alimentados una vez al día a saciedad a las 8 horas, 6 días / semana. A temperatura de 27,1 ± 0,3°C, pH 6,5 ± 0,2, alcalinidad 10 ± 01 mg/L. <strong>Resultados.</strong> Las hembras T1 no desovaron en tanto que las hembras T2 consiguieron seis desoves con 214 ± 28 huevos / desove y 167 ± 26 alevinos pareja. <strong>Conclusión.</strong><strong> </strong>Se demuestra que la calidad del alimento vivo es determinante para la reproducción de la variedad azul de la especie <em>M. ramirezi</em>.<strong></strong></p><p><strong>Palabras clave:</strong> Dieta viva, Fertilidad, Reproducción de ramirezi, Sobrevivencia.</p><p align="center"><strong>REPRODUCTIVE RESPONSE TO TWO DIFFERENT DIETS <em>Mykrogeophagus ramirezi</em>, var.</strong><strong> </strong><strong>Blue</strong><strong></strong></p> Elizabeth Aya-Baquero ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2925 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE LOS ÁCIDOS GRASOS POLIINSATURADOS SOBRE EL DESEMPEÑO Y PIGMENTACIÓN DE ALEVINOS DE TILAPIA NILÓTICA (Oreochromis niloticus) http://revistas.udenar.edu.co/index.php/revip/article/view/2995 <div class="WordSection1"><div class="WordSection1"><p><strong>Introducción: </strong>El interés científico por la nutrición de los peces es cada vez mayor, principalmente en cuanto a la composición de lípidos y particularmente, de ácidos grasos poliinsaturados, los cuáles han sido identificados como nutrientes clave en muchos procesos fisiológicos del pez. <strong>Objetivo: </strong>El objetivo de este estudio fue evaluar el efecto de diferentes relaciones de ácidos grasos poliinsaturados sobre parámetros de desempeño y pigmentación de alevinos de tilapia nilótica (<em>Oreochromis niloticus</em>). <strong>Métodos: </strong>Se utilizaron 2160 poslarvas de tilapia nilótica (<em>Orechromis niloticus</em>) con 13.61±1.76mg y 7257.3±97.4μm de peso y longitud inicial promedio respectivamente; se formularon y se suministraron dietas con ácido linoléico (AL) y ácido linolénico (ALN), con diferentes relaciones de inclusión de (AL: ALN): T1 (1,91:0,24), T2 (3,73:0,26) y T3 (3,82:0,09) respectivamente, cada uno con cuatro replicas y las mediciones y los resultados fueron obtenidos en la fase de alevino. <strong>Resultados: </strong>Para la variable sobrevivencia, no se observó diferencia significativa (Vp&gt;0,05) entre los diferentes tratamientos, sin embargo, la mayor media de la variable sobrevivencia se obtuvo en el T2 (68,19±19,55%) y la menor sobrevivencia en T3 (65,42±23,98%). Con respecto a la longitud se observó diferencia significativa (Vp&lt;0,05) entre los tratamientos, observándose la mayor longitud en T2 (29324,0±2709,3μm) y la menor en T1 (27018,6±2582,1μm). Para la variable peso, los mayores valores se obtuvieron en T2 (0,43±0,06 g), observándose  diferencia significativa (Vp&lt;0,05) entre los tratamientos T2 y los más bajos en T1 (0,34±0,03 g). El factor de condición de Fulton señaló que los peces no presentaron diferencia significativa (Vp&gt;0,05) en su grado de bienestar, T1 (1,76), T2 (1,75), T3 (1,75). El tratamiento con mayor pigmentación fue T2 (121,37±15,21). En pigmentación el T1 presentó un valor de (114,23±15,14) y T2 (121,23±15,94), y T3 (114,23±15,94), en este último se observó la menor pigmentación con diferencia significativa (Vp&lt;0,05), entre los diferentes niveles de inclusión, <strong>Conclusión: </strong>Los resultados obtenidos permiten concluir que niveles altos de ácidos grasos favorecen los parámetros zootécnicos como el peso y la longitud, además de aumentar la sobrevivencia y la pigmentación corporal de alevinos de tilapia nilótica.</p></div><p><strong>Palabras clave: </strong>ácido linoléico, ácido linolénico, ácido eicosapentaenoico, ácido docosaeicoxahenoico</p><p><strong> </strong></p><p><strong>EFFECT OF POLYUNSATURATED FATTY ACIDS ON PERFORMANCE ADN PIGMENTATION OF FINGERLINGS OF NILE TILAPIA (<em>Oreochomis niloticus</em>)</strong></p><p><strong> </strong></p></div> Jonny Andrés Yepes-Blandón ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2995 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE LA HARINA DE PULPA DE CAFÉ ADICIONADA A LA DIETA DE Piaractus brachypomus http://revistas.udenar.edu.co/index.php/revip/article/view/2926 <p><strong>Introducción. </strong>En acuicultura, el alimento equivale del 50-70% de los costos totales, los cuales resultan excesivos, especialmente cuando se trata de piscicultura rural; cualquier esfuerzo en este sentido, puede causar un gran impacto en la economía de la empresa. La pula de café es un residuo del beneficio de este producto, abundante en las zonas cafeteras, que ha sido probado en otras especies animales y puede resultar una alternativa para la alimentación de peces, con proceso adecuado, con el fin de disminuir los costos de producción. <strong>Objetivo.</strong> Evaluar el efecto de la harina de pulpa de café adicionada en niveles 10, 15 y 20% de la dieta, sobre el crecimiento de cachama blanca (<em>Piaractus brachipomus</em>), en la etapa de levante, en condiciones de acuario. <strong>Métodos.  </strong>El experimento se desarrolló durante 42 días, en los Laboratorios de Acuicultura de la Universidad de Nariño, Pasto, al suroccidente de Colombia, para lo cual se utilizó 84 animales con peso promedio de 16,57±2,78 g, los que fueron alimentados al 4% de la biomasa, distribuidos en cuatro grupos, recibiendo una dieta basada en alimento balanceado con el 38% de proteína (T1), adicionado con el 10% (T2), el 20% (T3) o el 30% de pulpa de café (T4), en un diseño completamente al azar con submuestreo, cuyas unidades experimentales estuvieron conformadas por un acuario con 35 litros de agua y siete peces. La pulpa de café fue hidrolizada con hidróxido de sodio, mezclada con melaza y ensilada por un período de 60 días, al cabo del cual fue deshidratada y molida; la harina fue adicionada al alimento mediante micromezclas, utilizando una solución de 0,5 g de almidón por litro de agua. Los acuarios se dispusieron aleatoriamente en un sistema de recirculación, con control digital de temperatura. La medición del peso y el ajuste de la dieta se hicieron semanalmente, muestreando la totalidad de animales. El plan manejo obedeció al protocolo establecido en el Laboratorio. <strong>Resultados.</strong> No se encontró diferencias significativas (p&gt;0,05) en el efecto de las diferentes dietas sobre el peso final (30,95±6,75 g), incremento de peso (14,80±3,71 g), tasa de crecimiento simple (0,0151±0,0105), conversión alimenticia (2,58±0,77) y supervivencia (97,6±3,2%). La calidad de agua se mantuvo estable y sin diferencias significativas. Si bien la conversión alimenticia puede parecer alta, se encuentra dentro del rango reportado por algunos autores. La relación benefició/costo fue superior en el T3 (COP$1,32) <strong>Conclusión:</strong> Estos resultados indican que al suministrar harina de pulpa de café adicionada en el alimento de cachama blanca, en la fase de levante, no se ve afectado el crecimiento, convirtiéndose en una alternativa para ser adicionada en la dieta de esta especie, entre el 10 y el 30% de la ración.</p><p><strong>Palabras clave: </strong>alimentación acuícola<em>, </em>residuos  agrícolas, costo de producción, incremento de peso, tasa de crecimiento simple.</p><p align="center"><strong>EFFECT OF COFFEE PULP FLOUR ADDED TO THE DIET OF <em>Piaractus brachypomus</em></strong></p> Adriana Elizabeth Cabrera-Jamauca ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2926 Tue, 06 Dec 2016 20:36:03 -0500 INCIDENCIA DE Piscinoodinium sp. EN SABALETA (Brycon henni) EN LA GRANJA POLITÉCNICO COLOMBIANO, ANTIOQUIA http://revistas.udenar.edu.co/index.php/revip/article/view/2928 <p><strong>Introducción.</strong> La sabaleta (<em>Brycon henni</em>) es un pez reofílico, endémico de las cuencas de los ríos y quebradas que se localizan entre los 1.200 y 2.200 msnm de la Región Andina colombiana. Es parte de la base alimenticia de los habitantes ribereños de estas zonas. Esta especie tiene problemas de conservación, en gran parte debido a la sobrepesca y contaminación de su hábitat, además se tiene poca información sobre las enfermedades que la puedan afectar. Uno de los principales problemas sanitarios son los parásitos, que suelen ser oportunistas, pero en grandes infestaciones sobre el huésped pueden causar estrés, inmunodeprimir y afectar el bienestar para finalmente causar la muerte. <strong>Objetivo. </strong>Evaluar la incidencia del ectoparásito <em>Piscinoodinium</em> sp. en la sabaleta en cautiverio de la granja del Politécnico Colombiano. <strong>Método</strong>. El estudio se realizó en la granja localizada en las coordenadas Latitud 6,43333 y Longitud -75,6833, a 780 msnm, T° promedio 27°C, mediante el seguimiento permanente por más de 24 meses de 230 reproductores de sabaleta. Se utilizó lista de chequeo, examen físico de aletas caudales, dorsales, pectorales y especialmente piel, escamas y branquias mediante la técnica de rutina con fijación en formol al 10% e incluidos en parafina, se realizaron cortes de 5 micrómetros y tinción con hematoxilina-eosina. Con ayuda del estereomicroscóopio, microscopio de luz se evaluó el grado de lesión y se procedió a identificar el agente etiológico. Luego se realizó estadística descriptiva, coeficiente de variación, correlaciones simples y diferencia de medias por Tukey con (p&lt;0,05) a las variables de estudio: morbi-mortalidad. <strong>Resultados. </strong>En el análisis macro y microscópico fue identificado el ectoparásito<strong> </strong><em>Piscinoodinum </em>sp. La tasa de incidencia de morbi-mortalidad fue mayor al 80% en los reproductores machos y hembras. Este ectoparásito se localizó principalmente en branquias y en menor proporción en el cuerpo y aletas. Las lesiones en branquias produjeron: irritación, inflamación e hipertrofia lamelar, así como hemorragias y desprendimiento de las laminillas del epitelio respiratorio, alteraciones que llevan a hipoxia, y por último la muerte. <strong>Conclusiones. </strong>De acuerdo con las observaciones y seguimiento de los ejemplares estudiados, se puede inferir que la sabaleta es una especie exigente en cuanto a calidad de agua y que el agua de pésima calidad puede hacer que este pez sufra estrés haciendo que los parásitos oportunistas afecten la salud causando mortalidad.</p><p><strong> </strong><strong>Palabras clave:</strong> Peces endémicos, salud, ectoparásitos</p><p align="center"><strong>INCIDENCE OF <em>Piscinoodinium </em>sp</strong>.<strong> IN SABALETA (<em>Brycon henni</em>) IN THE FARM POLITECNICO COLOMBIANO, ANTIOQUIA</strong></p> Luis Fernando Londoño-Franco ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2928 Tue, 06 Dec 2016 20:36:03 -0500 ESTANDARIZACIÓN DE UNA TÉCNICA DE PCR EN TIEMPO REAL PARA EL DIAGNÓSTICO DE Edwarsiella tarda. http://revistas.udenar.edu.co/index.php/revip/article/view/2929 <p><strong>Introducción:</strong> <em>Edwardsiella tarda</em>, es una bacteria Gram negativa perteneciente a la familia de las enterobacterias, aislada a lo largo del mundo en diferentes especies, principalmente acuática. En peces se manifiesta con pequeñas lesiones cutáneas que progresan a abscesos en musculo. Internamente se presenta una congestión generalizada similar a otras septicemias bacterianas. En Colombia ha sido aislada de tilapias (<em>Oreochromis </em>sp.) y actualmente son escasos los medios de diagnóstico molecular para su detección.<strong> Objetivo: </strong>Estandarizar una técnica de PCR en tiempo real (qPCR) para el diagnóstico de <em>E. tarda</em>.  <strong>Métodos:</strong> La estandarización de esta técnica se desarrolló en el laboratorio de biología molecular ASOACUICOLA – Universidad CES en Medellín Colombia. Se realizó el diseño de los <em>primers</em> utilizando el programa Primer3 Input (version 0.4.0)  a partir de la secuencia del gen de la membrana lipoproteica Pcp (<em>pcp</em>), Acceción: AF295331.1 y fueron preliminarmente evaluados por medio de amplificación de PCR <em>in silico </em>(<em>in silico </em>PCR amplification), para determinar su especificidad utilizando cepas bacterianas  ATCC<sup>®</sup> de <em>Streptococcus agalactiae, S. iniae, Aeromona salmonicida, A. hydrophila, Flavobacterium psycrophilum </em>y<em> Edwarsiella ictaluru</em>, y como control positivo la cepa de <em>E. tarda</em> - ATCC® 15947™. Para estandarizar la PCR convencional se utilizaron los <em>primers</em>: F- 5’CGCGCATAGTATCCTCAACA3´ y R-5’CGAACAGTGCTTAGCCCATT3´ y el kit PCR Master Mix 2X de Thermo Scientific™, modificando las concentraciones en sus diferentes componentes y se realizaron gradientes de temperatura para determinar el perfil térmico. Para la estandarización de la prueba de qPCR, se manejó el perfil térmico establecido con la PCR convencional. Para esta estandarización se utilizaron los reactivos TaqMan Environmental Master Mix 2.0 y el sistema Pathogen Mix, que incluía los <em>primers</em> mencionados más la sonda (FAM™ Probe) (FAM-5´CGTTTCAATAGTGTCATAGCGCCTGC 3´-NFQ). Como control endógeno (control de PCR) se empleó IPC TaqMan Exogenous (VIC™ Probe). <strong>Resultados:</strong> Se estableció una concentración mínima de sensibilidad de 1:10000 (0.15 fg/ µL) para la PCR convencional, un perfil térmico de la siguiente manera: precalentamiento: 60°C por 30 seg, Desnaturalización: 50°C por 2 min y 95°C por 10 min, 35 ciclos: 95°C por 15 seg, 57°C por 1 min. y alineamiento: 60°C por 30 seg. No se observó amplificación cruzada con otros géneros de bacterias, demostrando así una alta especificidad. Los resultados obtenidos en la qPCR demostraron una buena amplificación<strong>, </strong>obteniendo una mayor sensibilidad, lográndose detectar concentración de 1:100000 (0.015 fg/ µL). <strong>Conclusión:</strong> Los <em>primers</em> diseñados a partir del gen de la membrana lipoproteica Pcp (<em>pcp</em>) presentaron una alta especificidad para la detección de <em>E. tarda </em>evitando de esta manera una amplificación cruzada, que junto con la alta sensibilidad obtenida con la estandarización de la qPCRl, contribuyen para la realización de un diagnóstico sensible, confiable y rápido.</p><p><strong>Palabras clave:</strong> especificidad, sensibilidad, cepas, gen</p><p align="center"><strong><em> </em></strong></p><p align="center"><strong>TECHNICAL STANDARDIZATION OF A REAL-TIME PCR FOR DIAGNOSIS OF </strong><strong><em>Edwarsiella tarda.</em></strong></p> Cristian Leandro Cantor ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2929 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DE LOS EFECTOS TÓXICOS DEL CIANURO Y PROTECCIÓN DE TIOSULFATO DE SODIO EN Oreochromis sp. http://revistas.udenar.edu.co/index.php/revip/article/view/2931 <p><strong>Introducción.</strong> En Colombia, la minería se ha proyectado como un área de desarrollo para el país con el uso indiscriminado de químicos contaminantes como el cianuro, pero los riesgos ambientales y de salud pública ligados a esta actividad son altos con las limitaciones de control en el análisis y monitoreo que ejercen las autoridades ambientales sobre estos compuestos que se consideran efluentes contaminantes y tóxicos para peces nativos y exóticos. Objetivo. Determinar los efectos tóxicos generales del cianuro, el efecto protector de tiosulfato de sodio y las variaciones de los parámetros sanguíneos y bioquímicos de <em>Oreochromis</em> sp. expuesta a concentraciones agudas de cianuro de sodio. Métodos. Se trabajó con (36) <em>tilapia roja</em> (<em>Oreochromis </em>sp.), expuestos por 24 h a cuatro tratamientos; 1: grupo control (libre de sustancia); 2: 1 ppm de NaCN; 3: 1 ppm de NaCN y 50 ppm de tiosulfato de sodio; 4: 50 ppm de tiosulfato de sodio. Se evaluaron los efectos tóxicos generales y se tomaron muestras de sangre para hematocrito y parámetros bioquímicos (proteínas plasmáticas, glucosa y lactato). Los peces fueron eutanasiados y realizada la necropsia para colecta de, fragmentos de hígado y cerebro para determinar cualitativamente la presencia de cianuro por medio de la prueba del ácido pícrico. El análisis e interpretación de los resultados de las variables cualitativas se realizó mediante descripción de las mismas y comparación entre tratamientos, los datos de las variables cuantitativas fueron comparados por estadística descriptiva y la prueba de Tukey. Resultados. Dentro de los primeros 15 minutos los peces de los tratamientos 2 y 3 presentaron signos agudos de intoxicación como dificultad respiratoria, hiperactividad, nado errático hasta imposibilidad de movimiento. El hematocrito se encontró alto en los peces de los tratamientos 2 y 3 comparado con los de los tratamientos 1 y 4, los niveles de glucosa y lactato en sangre se encontraron significativamente altos (p&lt; 0,05) en los especímenes de los tratamientos 2 y 3; por el contrario el nivel de proteína plasmática no mostró diferencias significativas entre tratamientos. El resultado de la prueba del ácido pícrico no fue concluyente en hígado y cerebro. <strong>Conclusión.</strong> Alteraciones en el comportamiento son manifestaciones clínicas de intoxicación y es evidente que el NaCN en exposición aguda, afecta notoriamente los parámetros bioquímicos sanguíneos evaluados, que serían de gran utilidad para diagnosticar casos de sintomatología similar y con sospecha de cianurotoxicosis, el tiosulfato de sodio a la dosis usada no mostró su efecto protector, posiblemente por la gran sensibilidad de la especie a esta concentración del toxico.</p><p><strong>Palabras clave:</strong> Cianuro, glucosa, lactato, tilapia roja, tiosulfato de sodio</p><p align="center"><strong>EVALUATION EFFECTS TOXICS OF CYANIDE PROTECTIÓN OF TYOSULFFATE OF SODIUM ON <em>Oreochromis</em> sp.</strong></p><p align="center"><strong><em> </em></strong></p> Angi L. León-Pinzón ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2931 Tue, 06 Dec 2016 20:36:03 -0500 FACTORES ASOACIADOS A PROBLEMAS SANITARIOS POR INFECCIONES BACTERIANAS EN Oncorhynchus mykiss Y Oreochromis sp http://revistas.udenar.edu.co/index.php/revip/article/view/2934 <p><strong>Introducción.</strong> La presencia de enfermedades por agentes bacterianos causa alta morbi<del cite="mailto:Windows" datetime="2016-09-06T19:24">lidad y </del>mortalidad en <del cite="mailto:Windows" datetime="2016-09-06T19:24">los </del>cultivos de trucha arcoíris y de tilapia, representándose en pérdidas económicas para los sistemas de producción. Existen factores multicausales que favorecen la infección de estos agentes patógenos<ins cite="mailto:Windows" datetime="2016-09-06T19:29">, como factores</ins><del cite="mailto:Windows" datetime="2016-09-06T19:29">. </del><del cite="mailto:Windows" datetime="2016-09-06T19:25">Es a</del><del cite="mailto:Windows" datetime="2016-09-06T19:29">sí</del><del cite="mailto:Windows" datetime="2016-09-06T19:25"> como</del><del cite="mailto:Windows" datetime="2016-09-06T19:29">, las condiciones</del> f<ins cite="mailto:Windows" datetime="2016-09-06T19:33">i</ins>sic<ins cite="mailto:Windows" datetime="2016-09-06T19:25">o</ins><del cite="mailto:Windows" datetime="2016-09-06T19:25">as </del>qu<ins cite="mailto:Windows" datetime="2016-09-06T19:33">í</ins>micas del agua, <del cite="mailto:Windows" datetime="2016-09-06T19:25"> las </del>variables meteorológicas, <del cite="mailto:Windows" datetime="2016-09-06T19:25">e</del><del cite="mailto:Windows" datetime="2016-09-06T19:26">l </del>manejo y <del cite="mailto:Windows" datetime="2016-09-06T19:26">las </del>condiciones intrínsecas del individuo, pueden aumentar la frecuencia de las infecciones. <strong>Objetivo:</strong> Establecer la asociación entre  algunos factores medio ambientales, de manejo y condiciones del individuo con la presencia de infecciones bacterianas que afectan la sanidad. <strong>Métodos.</strong> Durante tres meses, se evaluaron 12 granjas de trucha y tilapia, donde se registró características del agua: oxígeno disuelto, porcentaje de saturación de oxígeno, temperatura, pH, alcalinidad, fosfatos, nitrógeno amoniacal, nitratos, sólidos totales, sólidos disueltos, coliformes totales y fecales. Se midieron algunas variables meteorológicas, <del cite="mailto:Windows" datetime="2016-09-06T19:30">las </del>condiciones intrínsecas <del cite="mailto:Windows" datetime="2016-09-06T19:30">del individuo </del>como talla, peso y sexo y se registraron las densidades de los cultivos, alimentación y uso de profilaxis.  Se tomaron 234 individuos de ambas especies y <del cite="mailto:Windows" datetime="2016-09-06T19:30"> </del>se extrajo ADN genómico <del cite="mailto:Windows" datetime="2016-09-06T19:33"> </del>a partir de un <em>pool</em> de cinco órganos blancos y se realizó q<del cite="mailto:Windows" datetime="2016-09-06T19:31">-</del>PCR Como prueba diagnóstica para determinar la presencia bacteriana: <em>Flavobacterium. psychrophilum</em> F<del cite="mailto:Windows" datetime="2016-09-06T19:34">- </del><ins cite="mailto:Windows" datetime="2016-09-06T19:34"> </ins><ins cite="mailto:Windows" datetime="2016-09-06T19:33">(</ins>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GACTCTATCGCAGCCGTTAC<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">)</ins>,  R<del cite="mailto:Windows" datetime="2016-09-06T19:34">-</del> <ins cite="mailto:Windows" datetime="2016-09-06T19:34">(</ins>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><ins cite="mailto:Windows" datetime="2016-09-06T19:33"> </ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GTCGTCGTCTGAATCCTCA<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">)</ins> y<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del><ins cite="mailto:Windows" datetime="2016-09-06T19:31"> </ins>Sonda  FAM<del cite="mailto:Windows" datetime="2016-09-06T19:34">-</del> <ins cite="mailto:Windows" datetime="2016-09-06T19:34">(</ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><ins cite="mailto:Windows" datetime="2016-09-06T19:33"> </ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GAC<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GGA<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>ACA<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GCA<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GAC<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GAT<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GAT<del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>GAC<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:31"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">)</ins> del gen gyrA (CAL42851.1);  <em>Aeromona<ins cite="mailto:Windows" datetime="2016-09-06T19:32">s</ins> salmonicida</em>  F<del cite="mailto:Windows" datetime="2016-09-06T19:34">-</del><ins cite="mailto:Windows" datetime="2016-09-06T19:34"> (</ins><del cite="mailto:Windows" datetime="2016-09-06T19:34"> </del>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>CACACTGAGCCTGTTCCAGA<ins cite="mailto:Windows" datetime="2016-09-06T19:34">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:35">)</ins><del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>,  R<del cite="mailto:Windows" datetime="2016-09-06T19:35">- </del><ins cite="mailto:Windows" datetime="2016-09-06T19:35"> (</ins>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:35">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>AGTCAGCTCGCCAAACAGAT<ins cite="mailto:Windows" datetime="2016-09-06T19:35">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:35">)</ins> y sonda FAM<del cite="mailto:Windows" datetime="2016-09-06T19:35">-</del><ins cite="mailto:Windows" datetime="2016-09-06T19:35"> (</ins><del cite="mailto:Windows" datetime="2016-09-06T19:35"> </del>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:35">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>GAA<del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>CAG<del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>CGC<del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>AAC<del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>CGG<del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>GGG<del cite="mailto:Windows" datetime="2016-09-06T19:32"> </del>ATTG<ins cite="mailto:Windows" datetime="2016-09-06T19:35">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:35"> </del>3’<ins cite="mailto:Windows" datetime="2016-09-06T19:35">)</ins> del gen fstB (AY455939.1); <em>Streptococcus iniae </em>F<ins cite="mailto:Windows" datetime="2016-09-06T19:35"> (</ins><del cite="mailto:Windows" datetime="2016-09-06T19:36">-</del>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:36">-</ins>GTTTGAAAGCTGAAGGGGTA<ins cite="mailto:Windows" datetime="2016-09-06T19:36">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:36">)</ins> , R<del cite="mailto:Windows" datetime="2016-09-06T19:36">- </del><ins cite="mailto:Windows" datetime="2016-09-06T19:36"> (</ins>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:36">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>CTTTTGGTGATAGGGCTTGT<ins cite="mailto:Windows" datetime="2016-09-06T19:36">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:36">)</ins> y Sonda  FAM<del cite="mailto:Windows" datetime="2016-09-06T19:36">-</del> <ins cite="mailto:Windows" datetime="2016-09-06T19:36">(</ins><del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>5’<ins cite="mailto:Windows" datetime="2016-09-06T19:36">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>GTT<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>CAA<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>GAG<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>TAT<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>CTC<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>CCA<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>AAT<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>GGG<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del>G<del cite="mailto:Windows" datetime="2016-09-06T19:36"> </del><ins cite="mailto:Windows" datetime="2016-09-06T19:36">-</ins>3’<ins cite="mailto:Windows" datetime="2016-09-06T19:36">)</ins> del gen LctO (Y07622.1); <em>Streptococcus agalactiae </em>F<del cite="mailto:Windows" datetime="2016-09-06T19:36">-</del><ins cite="mailto:Windows" datetime="2016-09-06T19:36"> (</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:37">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>GACATTACGGTTTGTTGGAA<ins cite="mailto:Windows" datetime="2016-09-06T19:37">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:37">)</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>, R<del cite="mailto:Windows" datetime="2016-09-06T19:37">- </del><ins cite="mailto:Windows" datetime="2016-09-06T19:37"> (</ins>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:37">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>AGCACACTTGAACCTTTTGA<ins cite="mailto:Windows" datetime="2016-09-06T19:37">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:37">)</ins> y Sonda FAM<del cite="mailto:Windows" datetime="2016-09-06T19:37">-</del><ins cite="mailto:Windows" datetime="2016-09-06T19:37"> (</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37">  </del>5<ins cite="mailto:Windows" datetime="2016-09-06T19:37">´</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37">’</del><ins cite="mailto:Windows" datetime="2016-09-06T19:37">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>TGG<del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>GAA<del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>AAA<del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>GAA<del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>GAT<del cite="mailto:Windows" datetime="2016-09-06T19:37"> </del>AGG<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>TTT<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>TGG<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>GT<ins cite="mailto:Windows" datetime="2016-09-06T19:38">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>3’<ins cite="mailto:Windows" datetime="2016-09-06T19:38">)</ins> del gen <ins cite="mailto:Windows" datetime="2016-09-06T19:38">c</ins><del cite="mailto:Windows" datetime="2016-09-06T19:38">C</del>apsular polysaccharide (AF332913.1) y para <em>Edwardsiella tarda </em>F<ins cite="mailto:Windows" datetime="2016-09-06T19:38"> (</ins><del cite="mailto:Windows" datetime="2016-09-06T19:38">-</del>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:38">-</ins><strong><del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del></strong>CGCGCATAGTATCCTCAACA<ins cite="mailto:Windows" datetime="2016-09-06T19:38">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:38">)</ins>,   R<del cite="mailto:Windows" datetime="2016-09-06T19:38">-</del><ins cite="mailto:Windows" datetime="2016-09-06T19:38"> (</ins>5´<ins cite="mailto:Windows" datetime="2016-09-06T19:38">-</ins><strong><del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del></strong>CGAACAGTGCTTAGCCCATT<ins cite="mailto:Windows" datetime="2016-09-06T19:38">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>3´<ins cite="mailto:Windows" datetime="2016-09-06T19:38">)</ins> y Sonda FAM<del cite="mailto:Windows" datetime="2016-09-06T19:38">-</del> <ins cite="mailto:Windows" datetime="2016-09-06T19:38">(</ins>5’<ins cite="mailto:Windows" datetime="2016-09-06T19:38">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>GTT<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>CAA<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>GAG<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>TAT<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>CTC<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>CCA<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>AAT<del cite="mailto:Windows" datetime="2016-09-06T19:38"> </del>GGG<del cite="mailto:Windows" datetime="2016-09-06T19:39"> </del>G<ins cite="mailto:Windows" datetime="2016-09-06T19:39">-</ins><del cite="mailto:Windows" datetime="2016-09-06T19:39"> </del>3’<ins cite="mailto:Windows" datetime="2016-09-06T19:39">)</ins>del gen Pcp (<a href="http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&amp;id=9965414" target="new_entrez">AF295331.1</a>). Para establecer la asociación entre las variables evaluadas y la frecuencia de las bacterias identificadas, se utilizó una regresión logística múltiple. <strong>Resultados. </strong>El porcentaje de infectados por <em>E.<ins cite="mailto:Windows" datetime="2016-09-06T19:28"> </ins>tarda</em> fue del 2,1%, de <em>F.<ins cite="mailto:Windows" datetime="2016-09-06T19:28"> </ins>psychophilum</em> fue del 5,9% y para <em>S</em>. <em>agalactiae</em> fue de <del cite="mailto:Windows" datetime="2016-09-06T19:28"> </del>3,4% para los demás agentes los resultados por qPCR no arrojaron diagnosticos positivos, aunque no se encontró relación estadísticamente significativa entre las infecciones y variables evaluadas. Se encontró que los animales con tallas menores a los 20 cm fueron los que dieron positivos en el diagnóstico, las piscícolas con mayor densidad de siembra fueron las más afectadas. <strong>Conclusiones: </strong>Los agentes bacterianos suelen ser parte de la biota de las fuentes de agua y actúan como agentes secundarios y oportunistas. Los peces con sistema inmune en desarrollo suelen ser los más afectados por cambios bruscos.</p><p> <strong>Palabras claves: </strong>Diagnostico<strong>, </strong>infecciones, acuicultura, monitoreo</p><p align="center"><strong>ASSOCIATED FACTORS TO HEALTH PROBLEMS FOR BACTERIAL INFECTIONS OF <em>Oncorhynchus mykiss</em> AND <em>Oreochromis</em> sp.</strong></p><p align="center"> </p> Lina Jhoanna Correa-Agudelo ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2934 Tue, 06 Dec 2016 20:36:03 -0500 CARACTERIZACIÓN TÉRMICA DEL LODO PRIMARIO GENERADO EN UN SISTEMA DE RECIRCULACIÓN ACUÍCOLA http://revistas.udenar.edu.co/index.php/revip/article/view/2933 <p><strong>Introducción.</strong>  Sistemas de recirculación para acuicultura (SRA) ofrecen mejor control del cultivo y medio ambiente, utilizándose para producir especies de alto valor comercial y ecológico. La remoción de sólidos es necesaria para disminuir cargas orgánicas e inorgánicas teniendo el lodo primario (LP) como residuo. Lodos retenidos en unidades primarias de tratamiento en SRA varían con la especie, tipo de ración, tasa de alimentación, fase de cultivo principalmente. Tales lodos tienen características de combustión y/o pirólisis específicas pudiendo ser evaluadas por análisis térmico, obteniendo las curvas Termogravimétrica (TG) y Diferencial Termogravimétrica (DTG) y observación de microestructura externa con ayuda de Microscopía Electrónica de Barrido (SEM – Scanning Electron Microscopy). </p><p><strong>Objetivo.</strong> Caracterizar el comportamiento de combustión y pirólisis y análisis microestructural de superficie por SEM de una muestra de LP proveniente del Decantador de Columna de Flujo Ascendente (DCFA) utilizado en el sistema de recirculación para acuicultura (SRA). <strong>Métodos.</strong> El lodo fue obtenido de un SRA de tilapia nilótica, retirado del fondo del DCFA por medio de una válvula tipo globo de 1” con precaución para evitar resuspensión del material ya sedimentado, siendo luego seco en estufa a 105°C hasta masa constante. Para la caracterización térmica del lodo seco se utilizó el equipo SDTQ 600 TA Instruments. Fue utilizado 1,50 mg de muestra, caracterizada en atmosfera oxidante (aire) e inerte (nitrógeno), con tasa de calentamiento de 20°C min<sup>-1</sup> de temperatura ambiente hasta 1000°C generando las curvas TG y DTG. Para el análisis de superficie se utilizó el equipo JEOL JSM-6010LA. La muestra fue colocada sin cápsulas metálicas y se colocó en una cinta de carbono, aplicando un potencial de 3kV con aumento de 85-250x.</p><p><strong>Resultados. </strong>Según las curvas TG y DTG existen tres etapas de quema y/o pirólisis: Etapa 1: hasta 180°C perdiendo masa por evaporación y compuestos orgánicos volátiles de baja estabilidad. Etapa 2: 250 – 385°C y Etapa 3: 420 – 550°C, la pérdida de masa se produce por degradación/descomposición de carbohidratos, proteínas, ácidos grasos mono y poliinsaturados, polisacáridos y exopilisacáridos contenidos en las células bacterianas como también de las mucosidades de los peces. Después de 600°C solo es encontrado partículas sólidas inorgánicas. La cantidad de cenizas es baja siendo de 27,7% para combustión y 31,2% para pirólisis. En el análisis de superficie por SEM del lodo retirado del DCFA fue detectada grande presencia de material sólido irregular y poroso, con pocas estructuras esféricas, pudiendo ser de carácter orgánico producto de ración no consumida, junto con los productos metabólicos de las tilapias y con similitud con los lodos primario de estaciones de tratamiento de aguas residuales domésticas.<strong>Conclusión.</strong> Existe presencia de agua libre, compuestos orgánicos e inorgánicos. Bajo contenido de cenizas indica un residuo a ser reaprovechado como bioenergía. Pérdida de estructuras esféricas por efecto del calor</p><p><strong>Palabras Clave: </strong>TG/DTG, Sedimentación, Microscopía Electrónica de Barrido, Lodo, Reúso de agua residual.</p><p align="center"><strong>THERMAL CHARACTERIZATION OF THE PRIMARY SLUDGE GENERATED IN A RECIRCULATING AQUACULTURE SYSTEM</strong></p> Yemall Alexander Maigual-Enriquez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2933 Tue, 06 Dec 2016 20:36:03 -0500 VARIACIÓN DE LA CAPACIDAD DE RETENCIÓN DE AGUA EN ESPECIES ÍCTICAS DULCEACUÍCOLAS ALMACENADAS EN CONGELACIÓN http://revistas.udenar.edu.co/index.php/revip/article/view/2935 <p><strong>Introducción. </strong>En Colombia, las especies ícticas dulceacuícolas son comercializadas en gran escala y poseen alto valor comercial. Es poca la información acerca de un sistema que permita evaluar objetivamente la pérdida de calidad organoléptica de éstas especies cuando se almacenan en congelación por tiempos prolongados. La pérdida de gran cantidad de agua de composición de las especies luego de ser almacenadas en congelación coadyuva a la pérdida de calidad del producto a ser comercializado. <strong>Objetivo. </strong>Determinar la tendencia de la capacidad de retención de agua en tres especies dulceacuícolas almacenadas en condiciones de congelación durante tres semanas. <strong>Metodología. </strong>Tres especies dulceacuícolas: tilapia nilótica (<em>Oreochromis niloticus</em>), sábalo (<em>Megalops atlanticus</em>)<em>,</em> y cachama blanca (<em>Piaractus brachypomus</em>) colectados en la ciudad  de Santa Marta Magdalena, fueron eviscerados y sometidos al proceso de congelación rápida (temperatura final en el centro térmico -25°C en seis horas) para luego ser almacenados a -25°C por tres semanas. Las determinaciones de capacidad de retención de agua (CRA), definida como la capacidad que tiene el músculo para retener el agua libre durante la aplicación de fuerzas externas como corte,  trituración y prensado. Estos procedimientos fueron realizados antes e inmediatamente después de congelar los peces en las semanas 1, 2 y 3 de almacenamiento. La CRA en cada caso se determinó por el método de prensado en papel de filtro. Los datos se procesaron y compararon para determinar la tendencia de las mediciones. <strong>Resultados.</strong> La CRA obtenidas para la tilapia nilótica fue de 73,43% en fresco,  67,81% recién congelada, 67,09% luego de la primera semana de almacenamiento, 66,10 luego de dos semanas y 63,64% al final de las tres semanas; para el sábalo fue 74,86%, 73,94%, 67,84%, 67,36 y 63,86 siguiendo el orden empleado en la tilapia nilótica Para la cachama blanca los valores obtenidos fueron 61,45%, 60,42%, 59,09% y 53,27% para cada uno de los tiempos y condiciones de los dos anteriores. La tendencia descendente de la CRA en todas las especies fue calculada con pendientes de -0,0034 para la tilapia nilótica, de -0,0032 para la cachama blanca y -0,0049 para el sábalo. <strong>Conclusión.</strong>  Se observó una tendencia descendente en las CRA de las tres especies dulceacuícolas estudiadas, que está dentro de lo esperado en el descenso de calidad a medida que pasa el tiempo de almacenamiento. Debido a las temperaturas de almacenamiento utilizadas (-25°C) los valores de CRA se encuentran todos por encima del 50% (límite teórico de calidad deteriorada en el pescado congelado).</p><p><strong>Palabras clave: </strong>agua libre, almacenamiento en congelación, calidad, frescura </p><p align="center"><strong>VARIATION OF WATER RETENTION CAPACITY IN FRESHWATER ichthyic SPECIES STORED IN FREEZING</strong></p><p align="center"><strong> </strong></p><p> </p> Alvaro Espeleta-Maya ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2935 Tue, 06 Dec 2016 20:36:03 -0500 CALIDAD MICROBIOLÓGICA DE LA CARNE DE TILAPIA ROJA (Oreochromis sp.) PROCEDENTE DE UNA PLANTA DE SACRIFICO EN TIERRALTA CÓRDOBA. http://revistas.udenar.edu.co/index.php/revip/article/view/2936 <p><strong>Introducción</strong>: En los últimos años, el consumo de alimentos de origen pesquero ha aumentado considerablemente debido a que constituyen una fuente de proteínas, vitaminas, minerales y ácidos grasos poliinsaturados. Cuando los productos pesqueros provienen de fuentes contaminadas o con una manipulación no adecuada, el consumo crudo o ligeramente cocido pueden ser causa de brotes de enfermedades que pueden conducir a problemas de salud pública. La tilapia Roja (<em>Oreochromis </em>sp<em>)</em> es muy apetecida por el consumidor, debido a su frescura, sabor, textura, color y pocas espinas intramusculares, es un producto atractivo desde el punto de vista nutricional ya que tiene un alto contenido de proteínas, vitaminas y minerales <strong>Objetivo:</strong> Evaluar la calidad microbiológica presente en la carne de Tilapia Roja procedente de una planta de sacrificio. <strong>Métodos: </strong>El estudio se llevó acabo en el laboratorio de Sanidad Acuícola de la Universidad de Córdoba. Se realizaron seis muestreos mensuales entre los meses de Noviembre del 2015 y Abril del 2016 en la planta de sacrificio, la cual está dividida en dos fases de proceso (entrada y salida), en cada fase se tomó en condiciones asépticas una muestra al azar de 10 g de carne de pescado, extrayendo 1 g de carne por pescado. El análisis microbiológico de las muestras se realizó empleando los procedimientos y técnicas recomendados y avalados por el INVIMA (Norma NTC ISO/IEC 17025:2005) Se realizó un recuento de coliformes totales y fecales del producto, presencia de <em>Salmonella</em> sp <em>Vibrio cholerae </em>y recuento de S<em>taphilococcus aureus</em>. <strong>Resultados:</strong> de los seis muestreos realizados en la entrada tres de estos presentaron recuento de coliformes fecales por encima de lo estipulado por el INVIMA en la Resolución número 776 de 2008, con un valor máximo de 75x10<sup>3 </sup>NMP.100 mL<sup>-1</sup>, un valor mínimo de 23x10<sup>1 </sup>NMP.100 mL<sup>-1</sup> y promedio de 21x10<sup>3 </sup>NMP.100 mL<sup>-1 </sup>entre muestreos. En cuanto a la fase de salida, se determinó al igual que en la entrada, de los 6 nuestros realizados 3 de estos presentaron recuento de coliformes fecales por encima de lo estipulado por el INVIMA, con un valor máximo de 24x10<sup>3 </sup>NMP.100 mL<sup>-1</sup>, un valor mínimo de 4x10<sup>1</sup>NMP.100 mL<sup>-1</sup>y promedio de 12x10<sup>3</sup>NMP.100 mL<sup>-1 </sup>entre muestreos. En cuanto al recuento en placa de <em>Staphylococcus aureus</em> coagulasa positivo no se lograron aislar cepas. La presencia de <em>Salmonella</em> sp fue positiva en todas la muestras y en cuanto a <em>Vibrio cholerae</em> su presencia fue negativa. <strong>Conclusión: </strong>La carne de tilapia roja no sale en condiciones aptas para el consumo, está expuesta a condiciones inadecuadas de higiene por parte de los operarios de la planta, además de una ineficiencia en el empleo de las buenas prácticas de manufactura</p><p><strong> </strong><strong>Palabras claves:</strong> carga bacteriana, Tilapia roja, <em>Staphilococcus aureus, Salmonellas </em>sp<em>, Vibrio cholerae, </em>coliformes totales y fecales</p><p align="center"><strong>MICROBIOLOGICAL QUALITY OF MEAT TILAPIA ROJA (Oreochromis sp) FROM PLANT TIERRALTA SACRIFICE IN CORDOBA</strong></p> Eneida Rosa Luna-Payares ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2936 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DEL PROCESO DE ELABORACIÓN DEL SURIMI OBTENIDO A PARTIR DE CACHAMA HIBRIDA Colossoma sp. http://revistas.udenar.edu.co/index.php/revip/article/view/2937 <p><strong>Introducción. </strong>El pescado es uno de los alimentos que poco se transforman a nivel mundial; su presentación generalmente es en fresco, congelado y últimamente en filete, lo que no permite consumos masivos en los niños y ancianos, por el contenido de espinas intramusculares en algunas especies como la cachama, además el olor característico del pescado hace que las amas de casa no lo consuman permanentemente como el pollo y la carne de res.  <strong>Objetivo. </strong>Evaluar las técnicas del procesamiento para obtener el Surimi a partir de la especie íctica continental Cachama hibrida (Colossoma macropomum x Piaractus brachypomus). <strong>Métodos.</strong> El proceso de elaboración del surimi se realizó en el laboratorio de post-cosecha de la Universidad de Córdoba; los peces fueron escamados, fileteados, cortados en trozos, lavado tres veces, molido y mezclado al cual se adiciono crioprotectores (sal, azúcar y polifosfato) con el fin de dar protección al producto durante su almacenamiento  en congelación, evitando el deterioro de sus propiedades funcionales, a su vez se les  realizaron análisis microbiológicos tomando como muestras 10 g de los bloque de surimi, identificando <em>Coliformes Totales, Coliformes fecales</em>, <em>Vibrio cholerae</em>, <em>Salmonella sp y</em> <em>Staphylococcus</em> <em>aureus</em>; con el fin de evaluar la calidad y condiciones sanitarias en la que se encontró el producto, y se realizaron  análisis bromatológico con muestras de 20 g de carne los día cero, treinta, sesenta y noventa, para evaluar la vida útil del producto. <strong>Resultados. </strong>Los bloques no presentaron contaminación con microorganismos patógenos durante el periodo de estudio (<em>Vibrio Cholerae, Salmonella sp </em>y<em> Staphylococcus aureus</em>), se encontraron valores de 4x10<sup>1 </sup>- 150x10<sup>3</sup> NMP. 100 ml<sup>-1</sup> de <em>Coliformes totales </em>y &lt; 0,5 – 3x10<sup>2</sup> NMP. 100 ml<sup>-1</sup> <em>Coliformes fecales</em> durante los análisis realizados. Los bloques de Surimi mostraron una concentración de proteína de 15,1%, humedad 27,50%, grasa 17,19%, ceniza 1,06%.<strong>Conclusión. </strong>Los bloques de carne de cachama presentaron buena estabilidad durante el periodo evaluado, ya que no presentaron concentraciones de bacterias patógenas y mostrando buenas propiedades nutritivas (proteína, humedad, grasa y ceniza) siendo aptos para el consumo humano. El Surimi mostró buenas características organoléptica, presentado un color rosado, mínimo olor y poco sabor a pescado. </p><p><strong>Palabras claves:</strong> Transformación, pescado, bloques, poscosecha, microorganismos</p><p align="center"><strong>EVALUATION OF THE PROCESS OF MAKING SURIMI OBTAINED FROM HYBRIDIZING CACHAMA</strong><strong><em> </em></strong><strong><em>Colossoma</em></strong><strong> sp.</strong><strong></strong></p> Dina L. Osten-Pedroza ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2937 Tue, 06 Dec 2016 20:36:03 -0500 PESCA ARTESANAL CON POTENCIAL ACUICOLA DE LA UNIDAD AMBIENTAL COSTERA, LLANURA ALUVIAL DEL SUR http://revistas.udenar.edu.co/index.php/revip/article/view/2938 <p>El trabajo pretendió reconocer los recursos hidrobiológicos de extracción artesanal de la Unidad Ambiental Costera de la Llanura Aluvial del Sur con el fin de diagnosticar y señalar el potencial acuícola de los recursos de pesca artesanal de estos ecosistemas, reconocidos a través de la información secundaria y primaria recogida a través de talleres con la comunidad en los municipios de la costa pacífica nariñense y posterior evaluación y análisis de datos cuantitativos, asociación entre variables y determinación de relación causal entre ellas.En Colombia, la producción pesquera promedio 160.000 tn.año<sup>-1</sup>, los pescadores artesanales marinos aportan 5.240 tn.año<sup>-1</sup> y continentales 29.000 tn.año<sup>-1</sup>. Entre los años 90 hasta el 2014, las capturas industriales han caído en 52,7%; la extracción artesanal 80%, mientras la acuicultura creció en 155%. Las capturas pesqueras desembarcadas en los puertos colombianos generan empleo a 37.000 personas ocupadas en faenas de pesca y procesamiento de productos pesqueros en plantas.La mayoría del pescado que consume el país proviene de pesquerías artesanales y de subsistencia. El consumo per cápita de pescado en Colombia ha registrado comportamiento ascensional de 2,5 kg (años 80), 4,3 kg (años 90) y actualmente en 6,4 kilogramos.La extracción de Camarón blanco y Camarón titi (41,7% y 58,3% respectivamente) se efectuó desde aguas superficiales del Pacífico. La pesca pelágica y demersal marino costera participó con 41000 tn<sup>3</sup>.año<sup>-1</sup> y aguas continentales 30000 tn<sup>3</sup>.año<sup>-1</sup>, todas dedicadas al mercado nacional que impacta a 15000 personas.La exportación de atún fue 56,43%, camarón de cultivo 30,1% y otros 15,47%; el municipio de Tumaco (2014) aportó 60,21 tn<sup>3</sup>.año<sup>-1</sup> con camarón de cultivo; en general este renglón produjo 2148,38 tn<sup>3 </sup>(2009 a 2014).Los Caladeros de la UAC como áreas del ecosistema marino, permitirá el uso espacio-temporal para los pescadores artesanales, teniendo en cuenta sus requerimientos frente a la influencia de las problemáticas de disminución del recurso y conflictos de uso, para apoyar la conservación de objetos de interés colectivo en su aprovechamiento sostenible del recurso hidrobiológico y pesquero. Las áreas de evaluación fueron Bazán (Punta Reyes), municipio de El Charco con 25 sitios de pesca; localidad de Mulatos-Naranjo con 16 puntos de captura y finalmente Mosquera con 6 puntos de colecta.La caracterización biológica de los caladeros de pesca artesanal de la sub-región Sanquianga-Gorgona en lo particular se analizaron las localidades Bazan, Mosquera y Mulatos-Naranjo. A partir de la información obtenida se definieron 15 especies con 12 géneros en la pesca artesanal; el género de pargos <em>Lutjanus</em> representa la mayor diversidad con tres especies; <em>Seriola</em> con dos poblaciones y los demás con una sola especie. Las artes de pesca utilizadas en la subregión de estudio corresponde a Espinel, Línea de mano, Malla corvinera y Transmallo camaronero con diferente frecuencia de acuerdo a la localidad Bazán, Mosquera y Mulatos-Naranjo.</p><p><strong>Palabras clave</strong>: recursos acuáticos, pesca blanca, aguas demersales, sobreexplotación</p><p><strong>ARTISANAL FISHING WHIT AQUACULTURE POTENTIAL OF COASTAL ENVIRONMENTAL UNIT, SOUTH FLOODPLAIN</strong></p> Julbrinner Salas-Benavides ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2938 Tue, 06 Dec 2016 20:36:03 -0500 ESTUDIO DE MERCADO Y CONSERVACIÓN DE CARNE DE PESCADO MEDIANTE ACEITES ESENCIALES http://revistas.udenar.edu.co/index.php/revip/article/view/3000 <p><strong>Introducción:</strong> Investigaciones realizadas con carne de pescado revelan susceptibilidad a la descomposición por factores como temperatura, humedad, captura, almacenamiento, manipulación, transporte y composición fisicoquímica. <strong>Objetivo:</strong> Estudiar la viabilidad de mercado y la capacidad inhibitoria de aceites esenciales obtenidos a partir de plantas medicinales del suroccidente colombiano. <strong>Métodos:</strong> La investigación de mercado se desarrolló con muestreo probabilístico aleatorio y estratificación proporcional con una muestra de 384 observaciones de estratos tres, cuatro, cinco y seis. Así mismo el comportamiento de la oferta se efectuó mediante muestreo intencional a 11 supermercados y 10 pescaderías de las principales plazas de mercado de Cali. La obtención de aceites se realizó por hidrodestilación, a partir de hojas y cascaras, de: eucalipto (Eucalyptus cinérea), limoncillo (Cymbopogon citratus), salvia (Austroeupatorium inulifolium), hierbabuena (Mentha piperita), cidron (Aloysia citriodora), albahaca (Ocimum campechianum); cascara de: naranja (Citrus aurantium), limón (Citrus limonia), mandarina (Citrus reticulata); y semillas de cardamomo (Elettaria cardamomum). La actividad antimicrobiana se evaluó por microdilución, con inóculos de 1 a 4 McFarland de: Salmonella typhi (ATCC19430), Escherichia coli (ATCC1053), Staphylococcus aureus (ATCC6538) y Listeria monocytogenes (ATCC 35152), donde se determinó la concentración mínima inhibitoria (CIM). <strong>Resultados: </strong>Descripción de fundamentos y las experiencias investigativas en la carne de pescado de los métodos de conservación como la congelación y refrigeración, secado, atmósfera modificada y vacío, irradiación, proceso a altas presiones, bioconservación, sustancias químicas, películas, recubrimientos comestibles, pulsos eléctricos y lumínicos. Se logró determinar que el consumo de la carne de pescado es mensual con cantidades de 700 g/hogar y la demanda real es 679 ton/año; los factores de compra de los diferentes tipos de carne está ligado al sabor, precio, contenido nutricional y tradición, la preferencia en cuanto a la presentación es filete y entero, la forma de conservación más representativa es congelado y empacado al vacío. Se observó en las pruebas in- vitro inhibición bacteriana en los aceites de eucalipto (16 mg/ml = S. typhi, y E. coli; de 8 mg/ml = S. aureus y L. monocytogenes), salvia (8 mg/ml = S. aureus y L. monocytogenes), cardamomo (16 mg/ml = S. typhi, 8 mg/ml E. coli; de 1 mg/ml = S. aureus y L. monocytogenes), hierbabuena (12 mg/ml = S. typhi, 8 mg/ml E. coli, S. aureus y L. monocytogenes), y albahaca (16 mg/ml = S. typhi, y E. coli). <strong>Conclusión:</strong> En el área de estudio existe desconocimiento acerca de las tecnologías emergentes de conservación de la carne de pescado, ya que el salado, la refrigeración, la congelación y el enlatado son los métodos comúnmente utilizados. Los aceites esenciales de eucalipto, salvia, cardamomo, hierbabuena y albahaca presentaron resultados de inhibición bacteriana.</p><p><strong>Palabras clave:</strong> inhibición, bacteria, consumidor, tecnología</p><p align="center"><strong>MARKET RESEARCH AND CONSERVATION OF FISH MEAT WITH ESSENTIAL </strong><strong>OILS</strong></p> Francisco Emilio Argote-Vega ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/3000 Tue, 06 Dec 2016 20:36:03 -0500 INDUCCIÓN HORMONAL Y DESCRIPCIÓN DE LAS CARACTERISTICAS SEMINALES DE Leporinus friderici http://revistas.udenar.edu.co/index.php/revip/article/view/2895 <p><strong>Introducción. </strong>El warakú tres puntos <em>(L. friderici)</em> es una de las especies con mayor valor comercial en el departamento del Vaupés y hace parte fundamental de la dieta de las comunidades indígenas. Debido a su potencialidad para la acuicultura, desde hace varios años se ha venido realizando investigaciones encaminadas a contribuir con la creación de un paquete tecnológico para su reproducción en cautiverio. <strong>Objetivo. </strong>Evaluar la efectividad de dos inductores hormonales sobre las características seminales de <em>L. friderici</em>. <strong>Métodos. </strong>Se<strong> </strong>capturaron en el río Vaupés machos sexualmente maduros con pesos promedios de 325±68 g  durante un periodo de 14 meses, los cuales fueron mantenidos en estanques en tierra a una densidad de un pez/m<sup>2</sup>. En la época reproductiva (marzo-mayo) se llevaron a cabo los siguientes tratamientos Tto 1: extracto de hipófisis de carpa (EHC) (4 mg/kg), Tto 2: Ovaprim® (0,9ml/kg) y Tto 3: Ovaprim® 0,1 ml/kg  + EHC 4 mg/kg. Como variables de respuesta se evaluó concentración espermática (10<sup>6</sup> espermatozoides/μl), movilidad masal (%), tiempo de activación (seg) y volumen (ml). <strong>Resultados. </strong>Todos los tratamientos respondieron positivamente 12 horas posterior a la inducción hormonal, a una temperatura de 27 ±1°C, el semen de los ejemplares es blanco lechoso con una alta viscosidad; el volumen de semen colectado en los machos inducidos con EHC fue en promedio de 3,4±0,6 ml, con Ovaprim® 2,4±0,3 ml y 2,8±1 ml con la combinación de EHC + Ovaprim®. La concentración espermática se encontró en promedio para todos los tratamientos en 25,892,727 de espermatozoides/μl. La movilidad espermática más alta se observó en los individuos inducidos con EHC (88,7±8 %) seguido de la combinación EHC + Ovaprim® (85±6 %) y Ovaprim® (76,2±10 %). El tiempo de activación para EHC fue de 57,2±13 seg, para el Ovaprim® 55±21 seg y para la combinación de 52,4±16 seg. Sin embargo no se observaron diferencias estadísticas significativas (P&gt;0.05) en todos los parámetros evaluados <strong>Conclusión. </strong>Las características de calidad seminal de <em>L. friderici </em>no presentan variaciones significativas ante la inducción hormonal con EHC, Ovaprim® y su combinación, siendo el semen obtenido de buena calidad, lo cual constituye un resultado importante para los procesos de reproducción inducida de esta especie.</p><p><strong>Palabras clave:</strong> espermatozoides, extracto de hipófisis de carpa, ovaprim, reproducción</p><p align="center"><strong>HORMONE INDUCTION AND DESCRIPTION OF SEMINAL FEATURES <em>Leporinus friderici</em></strong></p> Alexander Torres-Tabares ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2895 Tue, 06 Dec 2016 20:36:03 -0500 EFECTOS DEL FENANTRENO SOBRE CARACTERISTICAS DEL FILETE Y VARIABLES DE CRECIMIENTO DE CACHAMA BLANCA http://revistas.udenar.edu.co/index.php/revip/article/view/2932 <p><strong>Introducción. </strong>Los hidrocarburos aromáticos policíclicos (HAPs) son compuestos complejos cuyas fuentes principales son los procesos industriales y actividades antropogénicas, aunque también son provocados por fenómenos naturales como incendios, erupciones volcánicas, entre otros, generando efectos adversos sobre los organismos acuáticos que son expuestos. Diversas técnicas de laboratorio se han enfocado en evaluar los efectos por la exposición de estos compuestos, pero son pocos los estudios que han evaluado la composición nutricional del filete como biomarcador de contaminación, lo cual constituye una herramienta importante para complementar los resultados a nivel toxicológico. <strong>Objetivo. </strong>Evaluar el efecto del fenantreno (PHE) sobre la composición bromatológica del filete y algunas variables de crecimiento de cachama blanca (<em>Piaractus brachypomus</em>) durante una exposición subaguda. <strong>Métodos. </strong>60 Ejemplares juveniles de <em>P. brachypomus</em> con peso y longitud estándar promedio de 206,8±4,9 g y 17,8±0,1 cm, respectivamente, fueron expuestos durante un periodo de 21 días a 3 concentraciones de fenantreno (0,1; 1 y 10 µg/g) y un control (aceite de canola), el cual fue inyectado intraperitonealmente, previa dilución en aceite de canola. Se tomaron muestras de filete a la hora cero, a los 11 y 21 días de exposición, con el fin de determinar los efectos sobre la composición bromatológica y posibles cambios en el pH del filete; además, se calculó el factor de condición, índice hepatosomático e incremento de peso diario. Se utilizó un diseño con arreglo factorial 3 x 4 siendo el factor 1 el tiempo de exposición y el factor 2 los tratamientos. <strong>Resultados.</strong> En general, el análisis estadístico no evidenció diferencias significativas entre los tratamientos, ni entre los tiempos de muestreo, a excepción de cenizas e índice hepatosomático. Para el tratamiento control, los valores de materia seca, proteína, extracto etéreo y pH del filete fueron 19,9±0,3%, 13,4±0,9%, 0,4±0,5% peso fresco y 6,6±0,1, respectivamente, los cuales no presentaron diferencias estadísticamente significativas (p≥0,05); adicionalmente, estos valores son similares a datos reportados para el músculo de cachama blanca en cultivo. Con respecto a cenizas, el valor del control fue de 1,2±0,1% peso fresco, siendo estadísticamente menor que los 3 tratamientos de fenantreno (p≤0,05) y obteniendo el valor más alto para el tratamiento de 10 µg/g (1,8±0,03%). Por otro lado, el factor de condición y el incremento de peso diario no se vieron afectados por la exposición a fenantreno; sin embargo, el índice hepatosomático presentó diferencias significativas para el tratamiento con 0,1 µg/g con respecto al control para los 11 y 21 días de exposición, observándose una reducción en el tamaño del hígado. <strong>Conclusión.</strong> A pesar de que no se evidenciaron marcadas alteraciones en la mayoría de parámetros evaluados a causa de la exposición al fenantreno, fue posible observar alteraciones sobre el tamaño del hígado; por lo cual, será importante evaluar la actividad enzimática, histológica y molecular en el hígado de estos organismos con el fin de determinar una mayor especificidad de los efectos provocados por el fenantreno.</p><p><strong>Palabras clave:</strong> hidrocarburos, ecotoxicología, peces, músculo, proteína, biomarcadores</p><p align="center"><strong>EFFECTS OF PHENANTHRENE ON FILET AND GROWTH VARIABLES OF CACHAMA BLANCA</strong></p> Diego A. Mora-Solarte ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2932 Tue, 06 Dec 2016 20:36:03 -0500 CULTIVO DE BOCACHICO Prochilodus magdalenae EN SISTEMA BIOFLOC http://revistas.udenar.edu.co/index.php/revip/article/view/2907 <p><strong>Introducción</strong>. El Bocachico se cultiva en sistemas extensivos, con densidades menores de 1pez/m<sup>2</sup> y aguas de pobre calidad. No existen estudios adaptando esta importante especie para la seguridad alimentaria a sistemas de cultivos intensivos. En el país se está desarrollando los cultivos intensivos con tecnología biofloc (BFT), especialmente tilapias; los cuales se caracterizan por manejo de altas densidades, bajo consumo y control de la calidad del agua, espacios reducidos y aprovechamiento de la proteína de origen bacteriano; sin embargo, pocos son los estudios adaptando esta tecnología de cultivo a especies nativas con importancia comercial. <strong>Objetivo. </strong>Evaluar el desempeño zootécnico de <em>Prochilodus magdalenae</em> en cultivo con tecnología biofloc sometidos a tres densidades de siembra. <strong>Métodos. </strong>El estudio se llevó a cabo en el Instituto de Investigación Piscícola de la Universidad de Córdoba (CINPIC), Montería, Córdoba. Las bacterias nitrificantes (BN) para la formación del floc se tomaron del fondo de estanques de uso piscícola del CINPIC. Nueve tanques rectangulares en concreto, con volumen de cultivo de 6,6 m<sup>3</sup>, con aireación constante y cubiertas con polisombra, fueron utilizados. Alevinos de bocachico con peso promedio de 1,6 ± 0,2 g y 5,0 de longitud, se sembraron a densidades de 5 (T1), 10 (T2) y 20 (T3) peces/m<sup>3</sup>. Cada tratamiento se evaluó por triplicado durante 120 días de cultivo. Alimento comercial de 24% PB en presentación harina se ofreció a los alevinos.  El manejo del sistema se realizó con provisión de melaza y cal.<strong> </strong>La calidad del agua del sistema se controló con el registró diario de: oxígeno disuelto (OD), pH, temperatura; semanalmente se determinó: amonio, nitrito, nitrato, dureza y alcalinidad. <strong>Resultados. </strong>Temperatura, pH, OD, alcalinidad, dureza total, se registraron dentro del rango óptimo para el cultivo de la especie; así como, para el mantenimiento del sistema. El amonio osciló entre 1,2 ± 0,5 (T1) y 2,3 ± 2,4 mg/L (T3); nitritos en promedio en 0,7 ± 0,5 mg/L y fluctuación de nitratos entre 16,4 ± 11,2 (T1) y 19,2 ± 2,2 (T3) sin diferencia significativa entre los tratamientos para estos parámetros (p&gt;0,05). La relación C: N se mantuvo por debajo de 10:1 en todos los tratamientos. El mayor peso (T1=74,29 ± 16,0 g) y longitud final (T1=18,2 ± 1,2 cm) fueron obtenidos con la menor densidad evaluada; los menores peso (T3= 31,92 ± 1,2 g) y longitud final (T3=14,0 ± 0,1 cm) con la mayor densidad, observándose diferencia estadística entre estos valores (p&lt;0,05). La sobrevivencia osciló entre 78,9 ± 3,8% (T1) y 83,8 ± 0,6% (T3) sin diferencia estadística (p&gt;0,05). <strong>Conclusión. </strong> El cultivo de Bocachico en fase de levante es posible con tecnología biofloc y densidad de siembra cercana a los 10 peces/m<sup>3</sup>; esto permitiría la intensificación de los cultivos de la especie.</p><p><strong>Palabras clave: </strong>BFT, crecimiento, sistemas intensivos, macroagregados de floc, compuestos nitrogenados</p><p align="center"><strong>CULTURE OF BOCACHICO <em>Prochilodus magdalenae</em> IN BIOLFOC TECNOLOGY</strong></p> Martha Janeth Prieto-Guevara ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2907 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE LOS ÁCIDOS GRASOS POLIINSATURADOS SOBRE EL DESEMPEÑO Y PIGMENTACIÓN DE ALEVINOS DE TILAPIA NILÓTICA (Oreochromis niloticus) http://revistas.udenar.edu.co/index.php/revip/article/view/2939 <p><strong>Introducción:</strong> El interés científico por la nutrición de los peces es cada vez mayor, principalmente en cuanto a la composición de lípidos y particularmente, de ácidos grasos poliinsaturados, los cuáles han sido identificados como nutrientes clave en muchos procesos fisiológicos del pez. <strong>Objetivo:</strong> El objetivo de este estudio fue evaluar el efecto de diferentes relaciones de ácidos grasos poliinsaturados sobre parámetros de desempeño y  pigmentación de alevinos de tilapia nilótica (<em>Oreochromis niloticus</em>). <strong>Métodos:</strong> Se utilizaron 2160 poslarvas de tilapia nilótica (<em>Orechromis niloticus</em>) con 13,61±1,76mg y 7257,3±97,4μm de peso y longitud inicial promedio respectivamente; se formularon y se suministraron dietas con ácido linoléico (AL) y ácido linolénico (ALN), con diferentes relaciones de inclusión de (AL: ALN): T1 (1,91:0,24), T2 (3,73:0,26) y T3 (3,82:0,09) respectivamente, cada uno con cuatro replicas y las mediciones y los resultados fueron obtenidos en la fase de alevino. <strong>Resultados:</strong> Para la variable sobrevivencia, no se observó diferencia significativa (V<sub>p</sub>&gt;0,05) entre los diferentes tratamientos, sin embargo, la mayor media de la variable sobrevivencia se obtuvo en el T2 (68,19±19,55%) y la menor sobrevivencia en T3 (65,42±23,98%). Con respecto a la longitud se observó diferencia significativa (V<sub>p</sub>&lt;0,05) entre los tratamientos, observándose la mayor longitud en T2 (29324,0±2709,3μm) y la menor en T1 (27018,6±2582,1μm). Para la variable peso, los mayores valores se obtuvieron en T2 (0,43±0,06 g), observándose diferencia significativa (V<sub>p</sub>&lt;0,05) entre los tratamientos T2 y los más bajos en T1 (0,34±0,03 g). El factor de condición de Fulton señaló que los peces no presentaron diferencia significativa (V<sub>p</sub>&gt;0,05) en su grado de bienestar, T1 (1,76), T2 (1,75), T3 (1,75). El tratamiento con mayor pigmentación fue T2 (121,37±15,21). En pigmentación el T1 presentó un valor de (114,23±15,14) y T2 (121,23±15,94), y T3 (114,23±15,94), en este último se observó la menor pigmentación con diferencia significativa (V<sub>p</sub>&lt;0,05), entre los diferentes niveles de inclusión, <strong>Conclusión:</strong> Los resultados obtenidos permiten concluir que niveles altos de ácidos grasos favorecen los parámetros zootécnicos como el peso y la longitud, además de aumentar la sobrevivencia y la pigmentación corporal de alevinos de tilapia nilótica.</p><p><strong>Palabras clave:</strong> ácido linoléico, ácido linolénico, ácido eicosapentaenoico, ácido docosaeicoxahenoico.</p><p align="center"><strong>EFFECT OF POLYUNSATURATED FATTY ACIDS ON PERFORMANCE AND PIGMENTATION OF FINGERLINGS OF NILE TILAPIA </strong></p> John Elvis Acosta-Portillo ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2939 Tue, 06 Dec 2016 20:36:03 -0500 COMPOSICIÓN BROMATOLÓGICA EN FILETES DE WARAKÚ TRES PUNTOS (Leporinus friderici) CAPTURADOS EN EL RÍO VAUPÉS http://revistas.udenar.edu.co/index.php/revip/article/view/2941 <p><strong>Introducción. </strong>Estudios han demostrado que el aporte nutricional de la carne de peces varía entre especies e individuos de una misma especie, siendo la proteína y el perfil lipídico altamente relacionadas y afectadas por el hábito alimenticio, edad, variables físicas y químicas del habitad, entre otros factores. <strong>Objetivo.</strong> Determinar las características bromatológicas de la carne de peces de warakú tres puntos <em>(Leporinus friderici)</em>, durante un ciclo hidrobiológico. <strong>Métodos. </strong>Los peces fueron capturados mensualmente en el río Vaupés y sus afluentes en las comunidades indígenas de Yacayacá (N 01° 05' 00,5" W 070° 28' 19,4"), Piracemo (N 01° 19' 55,8” W 70° 23' 00,8") y Santa Cruz (N 01° 09' 27” W 70° 00' 24,3") durante un ciclo hidrobiológico (12 meses). Se realizó el análisis bromatológico a cada una de las muestras (n=149), según los métodos recomendados por la AOAC International: humedad por secado a 110°C durante 24 horas (N°952.08), proteína cruda (N°955.04), cenizas por combustión a 450°C durante 12 horas (N°938.08) y lípidos crudos (N°948.15). Los datos obtenidos de cada una de las variables determinadas se sometieron a un análisis descriptivo y se expresaron como media ± error estándar de la media (SEM). Posteriormente se utilizó un ANAVA para comparar cada una de las variables entre cada sitio de captura y cada fase del ciclo hidrobiológico, utilizando un diseño completamente al azar con arreglo factorial de 3 x 4. <strong>Resultados.</strong> Se observaron valores de humedad de 78,41± 1,43%, sin presentarse diferencias significativas (p&gt;0,05) entre cada punto de captura durante el ciclo hidrobiológico. De igual forma, la ceniza no presentó diferencias significativas (p&gt;0,05) entre sitios de captura durante el ciclo hidrobiológico, con los valores más altos de porcentaje de ceniza en filetes de peces de la comunidad de Santa Cruz con 1,87 ± 0,45% en aguas descendentes y los valores más bajos se presentaron en la comunidad de Piracemo con 1,68 ± 0,3% durante este período. Por otro lado, la proteína cruda no presentó diferencias significativas (p&gt;0,05) entre cada punto de captura durante el ciclo hidrobiológico, sin embargo, los valores más altos se presentaron en la comunidad de Piracemo en aguas descendentes con 18,52 ± 5,6% y los valores más bajos se observaron en filetes de peces capturados en Santa Cruz 12,80 ± 2,2% durante esta fase. En la determinación de lípidos crudos, se evidenciaron diferencias significativas (p&lt;0,05) durante la fase de aguas descendentes entre los sitios de captura de las comunidades de Santa Cruz y Piracemo, determinándose valores de 0,62 ± 0,36% y 1,45 ± 0,39 respectivamente.<strong>Conclusión. </strong>De acuerdo a los resultados obtenidos, se puede inferir que el filete de warakú tres puntos <em>(Leporinus friderici)</em> presenta valores de importancia nutricional durante el ciclo hidrobiológico estudiado; sin embargo, se puede presentar variación en los porcentajes de lípidos crudos en algunas fases del ciclo hidrobiológico pudiéndose asociar a la disponibilidad de alimento durante cada fase para esta especie.</p><p><strong> </strong><strong>Palabras clave: </strong>ciclo hidrobiológico, lípidos, nutrición<em>,</em> proteína</p><p align="center"><strong>BROMATOLOGICAL COMPOSITION IN THREE POINTS WARAKU STEAKS <em>(LEPORINUS FRIDERICI)</em> CAUGHT IN THE VAUPES RIVER</strong></p> José Andrés Ramirez-Saray ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2941 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO LA APLICACIÓN DE 17α,20β-DIHIDROXI-4-PREGNEN-3-ONA SOBRE LAS CARACTERÍSTICAS SEMINALES DE Sorubim cuspicaudus (SILURIFORMES: PIMELODIDAE) http://revistas.udenar.edu.co/index.php/revip/article/view/2993 <p><strong>Introducción</strong>. El bagre blanco (<em>Sorubim cuspicaudus</em>) es una especie vulnerable, importante en las pesquerías de las cuencas de los ríos Magdalena y Sinú. Esta especie es una alternativa para la diversificación de la producción acuícola debido a la buena aceptación de su carne y a su valor comercial. Adicionalmente, la demanda de alevinos de bagre Blanco para repoblamiento continúa en ascenso. Si bien, los protocolos de inducción con Ovaprim o extracto de hipófisis de carpa generan buenos resultados en esta especie, es importante probar alternativas de estímulo hormonal que aumenten los índices reproductivos. <strong>Objetivo.</strong> Evaluar el efecto de la aplicación exógena de <em>17α</em><em>, </em>20β-dihidroxi-4-pregnen-3-ona (17,20βP) y en combinación con Ovaprim en la respuesta a la inducción, volumen, tiempo de activación, movilidad, velocidad y concentración seminal en <em>Sorubim cuspicaudus. </em><strong>Métodos.</strong> Machos maduros<em>, </em>fueron seleccionados por la presencia de semen fluido al realizar presión abdominal leve y se dividieron en tres tratamientos de manera aleatoria (n=5): (i) Ovaprim en dosis única de 0,4 mL/kg, (ii) dosis única de Ovaprim de 0,4 mL/kg más una dosis única de 17,20βP de 1 µg/g de peso, 15 horas después de la aplicación del Ovaprim y (iii) 17,20βP en dosis única de 1µg/g peso (17,20βP). El semen fue colectado por presión abdominal, 12 horas después de la última dosis hormonal y la evaluación seminal se realizó mediante análisis asistido por computadora mediante el software Sperm Class Analizer SCA® (Microptic SL, España). <strong>Resultados.</strong> En el tratamiento 17,20βP, se obtuvo semen sólo en tres de los cinco machos inducidos, mientras que en los otros dos tratamientos respondieron positivamente todos los machos. El volumen seminal presentó diferencias estadísticas significativas entre los tratamientos (p˂0,05) y fue mayor en el tratamiento con Ovaprim (0,46±0,15 mL/100 g peso). El tiempo de activación no tuvo diferencias estadísticas significativas entre los tratamientos y se registró entre 31,355±3,12 y 34,085±4,74 segundos para los tratamientos Ovaprim y 17,20βP respectivamente. La concentración espermática reveló valores de 19.320,5±8.096,12 y 12.808,6±2.894,91 x 10<sup>6</sup> espermatozoides por mL para los tratamientos Ovaprim y Ovaprim+17,20βP y no mostró diferencias estadísticas significativas entre los tratamientos. Las velocidades: curvilínea, rectilínea, promedio y el índice de oscilación de los espermatozoides lentos, fueron mayores en el tratamiento Ovaprim+17,20βP y presentaron diferencias estadísticamente significativas entre los tratamientos. Adicionalmente la proporción de espermatozoides de velocidad media registraron diferencias estadísticamente significativas entre los tratamientos. En el tratamiento 17,20βP se encontró el mayor porcentaje de espermatozoides inmóviles y el menor de espermatozoides progresivos <strong>Conclusión.</strong> La aplicación intraperitoneal de <em>17α</em><em>,</em>20β-dihidroxi-4-pregnen-3-ona en una dosis única de 1µg/g peso, tuvo un efecto bajo en la espermiación, indujo un menor volumen espermático, aumentó la proporción de espermatozoides inmóviles, registró valores menores en las velocidades curvilíneas y rectilíneas, así como en los índices de linealidad, rectitud y oscilación, no incrementó el tiempo de activación ni la concentración espermática en comparación con la aplicación de Ovaprim en <em>Sorubim cuspicaudus.</em></p><p><strong>Palabras clave</strong>: bagre blanco, inducción hormonal, espermatozoide, esteroide inductor de la maduración</p><p><strong>EFFECT OF <em>17</em><em>α</em></strong><strong>,20β-DIHYDROXY-4-PREGNEN-3-ONE ON SEMINAL CHARACTERISTICS OF <em>Sorubim cuspicaudus</em> (SILURIFORMES, PIMELODIDAE)</strong></p> James Betancur-López ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2993 Tue, 06 Dec 2016 20:36:03 -0500 CULTIVO DE BOCACHICO Prochilodus magdalenae CON TECNOLOGÍA BIOFLOC: DINÁMICA DE LA CALIDAD DEL AGUA http://revistas.udenar.edu.co/index.php/revip/article/view/2943 <p><strong>Introducción</strong><strong>. </strong>En sistemas de cultivo con tecnología biofloc (BFT), la interacción entre comunidades planctónicas y microbiota permite establecer condiciones de mínimo o cero recambio de agua, junto a la remoción de nutrientes y producción de biomasa microbiana. Éstas características, están relacionadas con la dinámica de las variables de calidad de agua y el ciclo de reciclaje de compuestos nitrogenados, que permiten la estabilización y formación de macroagregados de floc. <strong>Objetivo. </strong>Describir la dinámica del sistema biofloc en función de las variables de calidad de agua en el cultivo de <em>Prochilodus magdalenae</em>. <strong>Métodos.</strong> En el Instituto de Investigación Piscícola de la Universidad de Córdoba (CINPIC), bacterias nitrificantes (BN) para la formación del floc, se tomaron del fondo de estanques de cultivo. Nueve tanques rectangulares en concreto (6,6 m<sup>3</sup>), cubiertas en polisombra, con aireación constante, fueron utilizados. Alevinos de bocachico con peso promedio de 1,6 ± 0,2 g se sembraron a tres densidades: 5 (T1), 10 (T2) y 20 (T3) peces/m<sup>3</sup>. Cada tratamiento se evaluó por triplicado durante 120 días de cultivo. Diariamente se registraron las variables: oxígeno disuelto (OD), temperatura, pH; cada tres días se determinó: alcalinidad total, nitrógeno amoniocal total (TAN), nitritos y nitratos; también se midieron sólidos sedimentables (SS), sólidos sedimentable totales (SST) e índice volumétrico de lodos (IVL); igualmente, la relación carbono: nitrógeno (C:N) para la definición del tiempo de estabilización y condiciones de manejo del sistema para la especie en cultivo. Alimento comercial de 24% PB, presentación harina, se ofreció como dieta a los alevinos, simultaneo al suministro de melaza y cal para el manejo de las variables del sistema. <strong>Resultados. </strong>En todos los tratamientos el OD estuvo por encima de<strong> </strong>6 mg/L, temperatura entre 27,5 ± 0,3°C (T1) y 30,1 ± 0,3°C (T2); pH entre 7,5 ± 0,2 y 8,5 ± 0,3, sin diferencia significativa entre los tratamientos evaluados (p&gt;0,05). La alcalinidad osciló entre 114,5 ± 57,9 (T2) y 95,3 ± 44,5 (T1) mg/LCaCO<sub>3</sub>. El TAN fluctuó entre 2,6 ± 1,1 (T1) y 5,1 ± 5,3 (T3) mg/L; amonio no ionizado entre 2,3 ± 2,4 (T3) y 1,2 ± 0,5 (T1) mg/L; nitritos entre 1,9 ± 0,1 (T2) y 0,1 ± 0,1 (T1) mg/L; nitratos entre 19,2 ± 2,2 (T3) y 16,4 ± 11,2 (T1) mg/L, estos parámetros presentaron diferencia estadística entre los tratamientos (p&lt;0,05). Los SS se encontraron en rangos inferiores a 1,5 ± 0,2 ml/L, con SST entre 121,5 ± 75,4 (T3)y 168,5 ± 62,4 (T1) mg/L, e IVL por debajo de 1 ml/mg, sin diferencia entre los tratamientos evaluados (p&gt;0,05). La relación C:N registró valores menores de 10:1. La estabilización del sistema solo fue posible hasta la semana 12 de cultivo. <strong>Conclusiones. </strong>Los rangos en las variables de calidad de agua se consideraron adecuados para el mantenimiento y ruta de nitrificación de las bacterias propias del sistema; las variaciones en los compuesto nitrogenados, permitieron la estabilización del floc a partir de la semana 12 de cultivo, con niveles bajos de sólidos y relación C: N con tendencia a la actividad de bacterias nitrificantes.</p><p><strong>Palabras clave: </strong>piscicultura, floc, compuesto nitrogenados, solidos suspendidos</p><p align="center"><strong>CULTURE OF THE BOCACHICO <em>Prochilodus magdalenae</em> WITH BIOFLOC TECNOLOGY: DYNAMICS ON WATER QUALITY<em></em></strong></p> Martha Janeth Prieto-Guevara ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2943 Tue, 06 Dec 2016 20:36:03 -0500 DESEMPEÑO PRODUCTIVO DE JUVENILES DE Piaractus brachypomus CULTIVADOS EN BIOFLOC CON CERO RECAMBIO DE AGUA http://revistas.udenar.edu.co/index.php/revip/article/view/2944 <p><strong>Introducción</strong>. Los flóculos bacterianos han demostrado ser una estrategia importante en los sistemas acuícolas intensivos y superintensivos. El cultivo con biofloc resulta ser una alternativa interesante donde se utiliza proteína de origen bacteriano de alto valor biológico como suplemento a la alimentación convencional. <strong>Objetivo</strong>. Se realizó un estudio durante 60 días con el objetivo de estimar los parámetros de crecimiento de juveniles de cachama blanca (<em>Piaractus brachypomus</em>) cultivados en sistema intensivo con tecnología biofloc (BFT) y sin BFT. <strong>Método</strong>. Fueron evaluadas dos estrategias productivas: T1 alimento balanceado de 24% de proteína de origen vegetal, y T2 alimento balanceado de 24% de proteína de origen vegetal en BFT. El alimento balanceado fue suministrado hasta saciedad aparente 4 veces al día. El cultivo se llevó a cabo en seis tanques plásticos circulares de un volumen total de 500 L cada uno a los cuales se les suministró aireación permanente con blower y manguera polidifusora ubicada en el fondo de cada tanque para mantener los sólidos en suspensión. En los tanques sin BFT se hicieron recambios semanales del 50% para mantener los parámetros de calidad de agua dentro de los rangos aceptados por la cachama. Fueron empleados 80 alevinos aparentemente sanos por tanque, con un peso promedio de 0,8 ± 0,33 g y una talla de 3,0 ± 0,4 cm. Variables de crecimiento como peso y longitud estándar (LE), y productivas como ganancias diarias de peso (GDP), biomasa (B), Factor de conversión alimenticia (FCA), tasa específica de crecimiento (TEC) (%/d) y porcentaje de sobrevivencia (%S) fueron estimadas cada quince días. Se determinaron los parámetros de calidad de agua dos veces al día (8:00 am y 5:00 pm), oxígeno disuelto (O.D), temperatura (<strong>°</strong>C), pH, salinidad (ppt) y sólidos suspendidos totales (SST). Semanalmente se determinó nitrógeno amoniacal total (NAT), nitrito, nitrato, alcalinidad y dureza. <strong>Resultados</strong>. Las GDP fueron 0,499±0.37 g y 0,425±0.4 g para T1 y T2 respectivamente, la biomasa final fue 2271±376 g para T1 y 1970,59±110,50 g para T2, mientras que el FCA fue 1,08±0,35 para T1 y 1,13±0,45 para T2, la TEC (%/d) 7,6±0 para T1 y 7,3±0 para T2 respectivamente, sin encontrarse diferencia significativa entre los tratamientos (p&gt;0,05). A cambio de esto, el tratamiento sin BFT consumió un 50% semanal más de agua que el BFT. La supervivencia fue más alta en T1.<strong>Conclusión</strong>. La utilización del biofloc representa un ahorro importante en agua, lo cual se traduce en menores costos de producción y mejor desempeño ambiental.</p><p><strong>Palabras clave</strong>: bacterias, BFT,<strong> </strong>Cachama blanca<em>, </em>Proteína vegetal, rendimiento</p><p align="center"><strong>PERFORMANCE OF <em>Piaractus brachypomus</em> JUVENILE CULTURED IN BIOFLOC SYSTEM WITH ZERO WATER EXCHANGE</strong></p> Sara Cristina Chaverra-Garces ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2944 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACION DE DIETAS EN EL CULTIVO DEL COPÉPODO Calanoide Parvocalanus crassirostris: PRODUCCIÓN DE NAUPLIOS http://revistas.udenar.edu.co/index.php/revip/article/view/2945 <p><strong>Introducción. </strong>La producción de zooplancton adecuado como presa viva en la fase de larvicultura es fundamental para alcanzar mayor sobrevivencia, facilitar procesos digestivos y estimular al desarrollo de enzimas endógenas en larvas altriciales. El copépodo <em>Parvocalanus crassirostris</em> presenta un elevado valor nutricional y pequeño tamaño de nauplio ideal para larvas de peces con apertura bucal reducida. No obstante, para la producción masiva de este calanoide se precisa definir una dieta apropiada que permita el mayor rendimiento en cultivo. <strong>Objetivo</strong>. Evaluar la producción poblacional de nauplios del copépodo <em>P. crassirostris</em> con el uso de tres dietas basadas en microalgas.<strong> Metodología</strong>. En el laboratorio de alimento vivo de la Universidad de Córdoba se realizaron cultivos del copépodo calanoide con tres dietas de microalgas combinadas a partir de las especies <em>Isochrysis galbana</em> (I), <em>Chaetoceros</em> sp. (C) y <em>Tetraselmis suecica</em> (T) en proporción de 50:50 correspondiente a 8µg biomasa seca. Bajo un diseño completamente al azar se trabajaron tres tratamientos T1 (I+C), T2 (T+I), T3 (C+T) con cuatro replicas cada uno. Botellones con 2,5 litros de agua marina se trabajaron a densidad inicial de 2 copépodos/ml, con aireación constante y fotoperiodo 8-16 horas luz/oscuridad para un total de doce unidades experimentales. Diariamente se registró la temperatura (ºC), salinidad (PSU), oxígeno disuelto (mg/L), pH y se evaluó cada 2 días la densidad y la composición poblacional durante el tiempo de cultivo. Fueron determinados los parámetros poblacionales: tiempo de duplicación (TD); tasa de crecimiento (TCE); rendimiento (R). La descripción morfométrica de los diferentes estadios del copépodo se realizó en 150 individuos. <strong>Resultados.</strong> Mayor densidad de nauplios en el cultivo se registró en el T1 (I+C), con valores de TCE=0,317693±0,05 días<sup>-1</sup>; R=0,51±0,07 org ml<sup>-1</sup> día<sup>-1</sup>, TD=2,36±0,34, con diferencias significativas (p&gt;0,05) respecto a los otros tratamientos. Los nauplios registraron una longitud total de 134,2 ± 8,9 µm y ancho del cuerpo con 66,0 ± 2,3 µm en promedio.<strong> Conclusiones.</strong> La dieta mixta de microalgas <em>I. galbana </em>(I), <em>Chaetoceros </em>sp<em>.</em> (C) permite una mayor eficiencia productiva del copépodo en el cultivo. Los resultados permiten establecer que la dieta es determinante en la productividad de nauplios. El pequeño tamaño de los nauplios hace viable esta especie de copépodo para su uso como presa viva a partir de la primera alimentación en larvas de peces con abertura bucal pequeña menor a 150 µm<strong>. </strong>El copépodo <em>Parvocalanus crassirostris</em> muestra propiedades ideales para el cultivo, constituyéndose como una alternativa más para su uso como alimento vivo en la acuicultura.</p><p><strong>Palabras claves:</strong> alimento vivo, zooplancton nauplios, microalgas</p><p> </p><p align="center"><strong>EVALUATION OF DIETS FOR CULTURE CALANOID<em> Parvocalanus crassirostris</em> COPEPOD:</strong><strong> </strong><strong>NAUPLII PRODUCTION</strong></p> Martha Janeth Prieto-Guevara ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2945 Tue, 06 Dec 2016 20:36:03 -0500 DIAFANIZACIÓN EN LARVAS DE Piaractus brachypomus USANDO COLORANTE DE Bixa Orellana http://revistas.udenar.edu.co/index.php/revip/article/view/2968 <p><strong>Introducción. </strong>Actualmente la técnica de diafanización empleada con rojo de alizarina genera costos elevados en la realización de protocolos para estudios de anatomía y sistemática en vertebrados. <strong>Objetivo.</strong> Realizar un protocolo de diafanización en larvas de cachama blanca (<em>Piaractus brachypomus) </em>usando colorante de <em>Bixa orellana </em>(achiote, urucú u onoto). <strong>Métodos. </strong>Se usaron larvas de cachama blanca de seis días pos-eclosión, las cuales fueron anestesiadas y fijadas en formol buferado 4%. El colorante de <em>B. orellana </em>fue obtenido mediante el proceso de remojo de las semillas con KOH 2% por doce horas. El líquido obtenido fue procesado con H<sub>2</sub>SO<sub>4 </sub>10% para la obtención de la pasta del colorante. Posteriormente, la pasta obtenida se procesó a temperatura de 50ºC por veinticuatro horas para la obtención del polvo. Las larvas de <em>P. brachypomus</em> se procesaron dentro de un diluyente de 0,1 g de colorante de <em>B. orellana</em> / 2 ml de KOH 2% por un periodo máximo de dos días. <strong>Resultados.</strong> El colorante de <em>B. orellana </em>presentó afinidad en estructuras con proceso de calcificación tales como: costillas, vertebras torácicas y caudales. El maxilar superior, inferior, arcos branquiales y aleta pectoral, fueron principalmente pronunciados por la coloración a diferencia de las demás estructuras anteriormente mencionadas. El tejido en proceso de osificación se coloreó de amarillo a naranja intenso. En la aleta caudal, la formación de radios se observaron contrastados por el colorante de <em>B. orellana</em>. <strong>Conclusión. </strong>El colorante de <em>B. orellana</em> es viable en la tinción de estructuras en proceso de osificación en larvas de <em>P. brachypomus</em>, permitiendo obtener resultados satisfactorios a muy bajos costos. Lo anterior, promueve la necesidad de seguir realizando ensayos en las etapas del desarrollo en especies de cada grupo taxonómico, facilitando crear protocolos viables para el manejo técnico y producción de nuevo conocimiento.</p><p><strong>Palabras clave: </strong>achiote, cachama blanca, transparentación, tinción ósea</p><p align="center"><strong>DIAPHANISATION IN LARVAE OF <em>Piaractus brachypomus </em>USING DYE OF <em>Bixa orellana</em></strong></p><p> </p> Yeferson Andres Moreno-Guerra ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2968 Tue, 06 Dec 2016 20:36:03 -0500 ENSAYOS DE MASCULINIZACIÓN DE TRUCHA ARCOÍRIS (Oncorhynchus mykiss) SUMINISTRANDO Tribulus terrestris EN EL ALIMENTO http://revistas.udenar.edu.co/index.php/revip/article/view/2955 <p><strong>Introducción.</strong> La producción de trucha arcoíris ha ocupado un eslabón muy significativo en la actividad económica de la cadena de la piscicultura del país. Se requiere para el engorde poblaciones monosexo hembras que se obtienen mediante importación con altos riesgos sanitarios u obtenidas indirectamente a partir del uso de neomachos producidos con hormonas sintéticas con efectos contaminantes. El <em>Tribulus terrestris</em> es una planta herbácea cuyos compuestos bioactivos son capaces de inducir la producción de testosterona y no genera riesgo ambiental cuando es usada en procesos de inversión sexual en peces. <strong>Objetivo.</strong> Determinar el porcentaje de neomachos de trucha arcoíris <em>(O. mykiss),</em> obtenidos a partir de la utilización de <em>T. terrestris</em> en el alimento. <strong>Métodos.</strong> El experimento fue llevado a cabo en el municipio de Rionegro (Antioquia). Se trabajó con 1.200 larvas 100% hembras adquiridas comercialmente, que se repartieron equitativamente en 12 tanques de concreto. Se les suministró concentrado comercial con el 50% de PB desde el día 15 poseclosión y durante 96 días con los siguientes tratamientos: 3.000 mg de TT/kg de alimento (tratamiento A), 5.000 mg TT/kg de alimento (tratamiento B), control positivo 3 mg de MT/kg de alimento (tratamiento C) y control negativo con etanol (tratamiento D). Se hizo determinación de parámetros productivos y de la diferenciación gonadal mediante la técnica de squash. Se midieron parámetros fisicoquímicos del agua. <strong>Resultados.</strong> Las ganancias diarias de peso fueron 0,128, 0,132, 0,109 y 0,088 g/d para los tratamientos A, B, C y D respectivamente. Las ganancias de talla se encontraron entre 0,063 cm (D) y 0,077 cm (B); ambas variables tuvieron diferencia estadística significativa (p&lt;0,05). La sobrevivencia, el factor de conversión alimenticia y la incidencia de costos no estuvieron afectados significativamente por los tratamientos. Con cada tratamiento A y B se obtuvo un porcentaje de machos de 2,67% (p&lt;0,05) y hubo presencia de intersexos pero sin significancia estadística. <strong>Conclusión.</strong> Los resultados permitieron concluir que <em>Tribulus terrestris</em> mezclado con concentrado en dosis de 3.000 mg/kg y de 5.000 mg/kg no induce la masculinización de la trucha arcoíris; sin embargo, no incide negativamente en la sobrevivencia de la misma, ejerce un efecto anabólico significativo, reflejado en ganancias de peso y talla y no resulta costoso utilizarlo comparado con el método convencional de la 17α-metiltestosterona; sin embargo, no se recomienda su uso para este fin por la ineficiencia. Es el primer estudio que se reporta en Colombia al respecto.</p><p><strong>Palabras clave</strong><strong>:</strong> inversión sexual, neomachos, protodioscina, hormona</p><p align="center"><strong>MASCULINIZATION ASSAYS OF RAINBOW TROUT (<em>Oncorhynchus mykiss</em>) FEEDING WITH <em>Tribulus terrestris</em></strong></p><p> </p> Juan Diego Manrique ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2955 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO LA APLICACIÓN DE 17α,20β-DIHIDROXI-4-PREGNEN-3-ONA SOBRE LAS CARACTERÍSTICAS SEMINALES DE Sorubim cuspicaudus (SILURIFORMES: PIMELODIDAE). http://revistas.udenar.edu.co/index.php/revip/article/view/2956 <p><strong>Introducción</strong>. El bagre blanco (<em>Sorubim cuspicaudus</em>) es una especie vulnerable, importante en las pesquerías de las cuencas de los ríos Magdalena y Sinú. Esta especie es una alternativa para la diversificación de la producción acuícola debido a la buena aceptación de su carne y a su valor comercial. Adicionalmente, la demanda de alevinos de bagre Blanco para repoblamiento continúa en ascenso. Si bien, los protocolos de inducción con Ovaprim o extracto de hipófisis de carpa generan buenos resultados en esta especie, es importante probar alternativas de estímulo hormonal que aumenten los índices reproductivos. <strong>Objetivo.</strong> Evaluar el efecto de la aplicación exógena de <em>17α</em><em>, </em>20β-dihidroxi-4-pregnen-3-ona (17,20βP) y en combinación con Ovaprim en la respuesta a la inducción, volumen, tiempo de activación, movilidad, velocidad y concentración seminal en <em>Sorubim cuspicaudus. </em><strong>Métodos.</strong> Machos maduros<em>, </em>fueron seleccionados por la presencia de semen fluido al realizar presión abdominal leve y se dividieron en tres tratamientos de manera aleatoria (n=5): (i) Ovaprim en dosis única de 0,4 mL/kg, (ii) dosis única de Ovaprim de 0,4 mL/kg más una dosis única de 17,20βP de 1 µg/g de peso, 15 horas después de la aplicación del Ovaprim y (iii) 17,20βP en dosis única de 1µg/g peso (17,20βP). El semen fue colectado por presión abdominal, 12 horas después de la última dosis hormonal y la evaluación seminal se realizó mediante análisis asistido por computadora mediante el software Sperm Class Analizer SCA® (Microptic SL, España). <strong>Resultados.</strong> En el tratamiento 17,20βP, se obtuvo semen sólo en tres de los cinco machos inducidos, mientras que en los otros dos tratamientos respondieron positivamente todos los machos. El volumen seminal presentó diferencias estadísticas significativas entre los tratamientos (p˂0,05) y fue mayor en el tratamiento con Ovaprim (0,46±0,15 mL/100 g peso). El tiempo de activación no tuvo diferencias estadísticas significativas entre los tratamientos y se registró entre 31,355±3,12 y 34,085±4,74 segundos para los tratamientos Ovaprim y 17,20βP respectivamente. La concentración espermática reveló valores de 19.320,5±8.096,12 y 12.808,6±2.894,91 x 10<sup>6</sup> espermatozoides por mL para los tratamientos Ovaprim y Ovaprim+17,20βP y no mostró diferencias estadísticas significativas entre los tratamientos. Las velocidades: curvilínea, rectilínea, promedio y el índice de oscilación de los espermatozoides lentos, fueron mayores en el tratamiento Ovaprim+17,20βP y presentaron diferencias estadísticamente significativas entre los tratamientos. Adicionalmente la proporción de espermatozoides de velocidad media registraron diferencias estadísticamente significativas entre los tratamientos. En el tratamiento 17,20βP se encontró el mayor porcentaje de espermatozoides inmóviles y el menor de espermatozoides progresivos <strong>Conclusión.</strong> La aplicación intraperitoneal de <em>17α</em><em>,</em>20β-dihidroxi-4-pregnen-3-ona en una dosis única de 1µg/g peso, tuvo un efecto bajo en la espermiación, indujo un menor volumen espermático, aumentó la proporción de espermatozoides inmóviles, registró valores menores en las velocidades curvilíneas y rectilíneas, así como en los índices de linealidad, rectitud y oscilación, no incrementó el tiempo de activación ni la concentración espermática en comparación con la aplicación de Ovaprim en <em>Sorubim cuspicaudus.</em></p><p><strong>Palabras clave</strong>: bagre blanco, inducción hormonal, espermatozoide, esteroide inductor de la maduración</p><p align="center"><strong>EFFECT OF <em>17</em></strong><em><strong>α</strong></em><strong>,20</strong><strong>β</strong><strong>-</strong><strong>DIHYDROXY-4-PREGNEN-3-ONE ON SEMINAL CHARACTERISTICS OF </strong><strong><em>Sorubim cuspicaudus</em></strong><strong> (SILURIFORMES, PIMELODIDAE).</strong></p><p align="center"> </p> James Betancur-López ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2956 Tue, 06 Dec 2016 20:36:03 -0500 CARACTERÍSTICAS SEMINALES DE NEOMACHOS DE TRUCHA ARCOÍRIS (Oncorhynchus mykiss) TRATADOS CON EXTRACTO PITUITARIO DE SALMÓN http://revistas.udenar.edu.co/index.php/revip/article/view/2960 <p><strong>Introducción. </strong>La trucha arcoíris es la tercera especie en volumen de producción en la piscicultura colombiana. Este país, depende casi exclusivamente de la importación de ovas embrionadas 100% hembras; sin embargo, en el departamento de Antioquia existen algunas granjas dedicadas a la producción de semilla nacional 100% hembras mediante neomachos. Estos individuos poseen fenotipo de macho con genotipo de hembra, por lo que todos sus espermatozoides portan el cromosoma X. Los neomachos representan un costo extra para las granjas productoras de alevinos, puesto que, en la mayoría de los casos, sus testículos carecen de conductos y deben ser sacrificados para la obtención de semen. <strong>Objetivo.</strong> Evaluar el efecto de tres dosis de extracto pituitario de salmón (EPS) sobre el índice gonadosomático (IGS), volumen, movilidad, duración del movimiento y concentración espermática en neomachos de trucha en una operación comercial de producción de alevinos en el departamento de Antioquia. <strong>Métodos.</strong> Neomachos de trucha, fueron tratados con EPS en tres diferentes dosis: 1. Aplicación única de 80 mg kg<sup>−1</sup> de peso total, 2. Aplicación única de 100 mg kg<sup>−1</sup>  y 3. Aplicación de 10 mg kg<sup>−1 </sup>y una segunda dosis de 80 mg kg<sup>−1 </sup>tres días después. El grupo control fue inyectado con solución salina 0,6%. El semen se colectó <em>post mortem</em>, tres días después de la administración de EPS y se realizó análisis manual de las características seminales. El análisis estadístico, se llevó a cabo a partir de un análisis de varianza de una vía, la normalidad de la distribución de los datos se evaluó mediante una prueba de Shapiro-Wilk, la homocedasticidad se analizó por medio de una prueba de Bartlett y las diferencias entre medias, se evaluaron mediante pruebas de Tukey con el programa R. <strong>Resultados. </strong>No se encontraron diferencias estadísticas significativas entre las dosis de EPS en ninguna las variables observadas. Un tercio de todos los animales examinados, presentaron gónadas no desarrolladas o bisexuales, el resto fueron neomachos con ductos espermáticos obstruidos. El IGS varió entre 2,95±1,98% y 4,71±3,66% en el control y el tratamiento con dos dosis de EPS, respectivamente. El volumen seminal fue menor en el control comparado con las tres dosis de EPS probadas (0,91±0,75 vs 1,46±1,46, 1,61±1,89 y 2,59±1,89 mL/100g respectivamente). La movilidad en el control fue menor (10±8,66%) comparado con los tratamientos 1, 2 y 3 (26,66±20,81%, 26,66±28,86% y 33,33±11,54% respectivamente). La duración del movimiento de los espermatozoides fue mayor en los tratamientos 2 y 3 (39,73±6,96 y 33,58±4,98 segundos respectivamente) comparado con el control (23,63±2,6 segundos). La concentración espermática del control fue de 34,7±4,25 espermatozoiddes x 10<sup>9</sup> mL<sup>-1</sup> y fue entre 1,26 a 3,65 veces mayor a los tratamientos con EPS. <strong>Conclusión. </strong>Los resultados del presente estudio, sugieren que, en algunos casos, dos dosis de EPS (10 mg kg<sup>−1 </sup>y 80 mg kg<sup>−1</sup> tres días después) pueden incrementar el IGS, volumen, duración y movilidad espermática en neomachos de trucha, dependiendo de la efectividad en la selección de los individuos para tratamiento y la reversión hormonal previa para generar testículos desarrollados incluso con obstrucciones.</p><p> <strong>Palabras clave:</strong> hembras revertidas sexualmente, movilidad, poblaciones monosexo, volumen seminal </p><p align="center"><strong>SPERM CHARACTERISTICS OF RAINBOW TROUT NEOMALES (<em>Oncorhynchus mykiss</em>) INDUCED BY SALMON PITUITARY EXTRACT.</strong></p> Andrés F. Montoya-López ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2960 Tue, 06 Dec 2016 20:36:03 -0500 CARACTERIZACIÓN SEMINAL DE Glyptoperichthys gibbiceps (PISCES: LORICARIDAE). http://revistas.udenar.edu.co/index.php/revip/article/view/2963 <p><strong>Introducción</strong>. La especie <em>G. gibbiceps</em>, más conocida como cucha mariposa o leopardo, es uno de los loricáridos de mayor porte que son capturados y comercializados para la exportación desde Colombia. Características como resistencia a la manipulación, diseño reticular y preferencias algófagas, la hacen atractiva para el acuarismo; sin embargo, los estudios enfocados en producirle en confinamiento son limitados. Por lo tanto, son justificadas las investigaciones tendientes a generar información básica y en especial de su biología reproductiva, que posibilite el cultivo de este pez. El presente trabajo buscó generar información sobre la calidad seminal de la especie, planteándose el siguiente <strong>Objetivo:</strong> Caracterización del semen de la cucha mariposa. <strong>Métodos.</strong> El estudio se llevó a cabo en la estación piscícola y laboratorios del Instituto de Acuicultura IALL. Doce (12) machos fueron distribuidos en cuatro tratamientos (T) de inducción hormonal así: T1 = EHC 4 mg/kg; T2 = Ovaprim 0,8 mL/kg; T3 = EHC/Fertivet<sup>®</sup> (4 mg/kg + 200 UI/kg) y,  T4 = Ovaprim/Fertivet<sup>®</sup> (0,08 mL/ kg + 200 UI/ kg), administrados en dosis única. A todos los individuos tratados se les extrajo el semen 15 h pos-inducción hormonal. En los cuatro tratamientos el semen fue obtenido mediante estrujamiento e inmediatamente volumetrado con micropipeta. La movilidad masal y el tiempo de activación espermática determinados a través de microscopio óptico y la concentración espermática por dilución y conteo en cámara de Neubauer. La viabilidad fue establecida por conteo de células con coloración diferencial de eosina-nigrosina.<strong> Resultados.</strong> El volumen de semen obtenido fue de 43,3 ± 15,27 μL (T1)  30,0 ± 0,0 μL (T2)  26,6 ±11,54 μL (T3) y 53,3 ± 11,54 μL (T4). La concentración espermática para el T1 fue de 6,56 x 10<sup>5 </sup>±4,5 x 10<sup>4</sup>, T2 = 1,51 x 10<sup>6 </sup>± 6,5 x 10<sup>4</sup>, T3 =  8 x 10<sup>5 </sup>±11 x 10<sup>4 </sup>y T4 = 1,4 x 10<sup>6 </sup>±15 x 10<sup>4</sup> espermatozoides / μL. La viabilidad (células vivas) para los 4 tratamientos fue superior al 95 %, la movilidad masal fue del 80% y el tiempo de activación fluctuó entre 56 y 60 min. <strong>Conclusión.</strong> Este es uno de los primeros trabajos que se desarrollan en este tema para la cucha mariposa, por lo tanto se hace necesario seguir investigando y de esta manera contribuir a la consolidación de una base primordial de información. Datos interesantes como su extenso tiempo de activación espermática (&gt; 50 minutos) la hace una especie única con esta característica.</p><p><strong>Palabras clave: </strong>calidad seminal, concentración espermática, viabilidad espermática, volumen seminal</p><p align="center"><strong>SEMINAL CHARACTERIZATION OF<em> Glyptoperichthys gibbiceps</em> (PISCES:</strong><strong> LORICARIDAE).</strong></p> Yuly Alexandra Contreras-Barbosa ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2963 Tue, 06 Dec 2016 20:36:03 -0500 VIABILIDAD REPRODUCTIVA DE LOS PECES MIGRATORIOS AGUAS ARRIBA DE LA HIDROELÉCTRICA URRÁ http://revistas.udenar.edu.co/index.php/revip/article/view/2951 <p><strong>Introducción. </strong>La Hidroeléctrica Urrá (HU) fragmentó al río Sinú en tres sectores: aguas arriba, el embalse y aguas abajo; poblaciones de peces quedaron aisladas aguas arriba y desde al año 2000 se realizan repoblamientos con peces migratorios en el embalse; sin embargo<ins cite="mailto:N.N" datetime="2016-08-25T13:31">,</ins> no se conoce la dinámica reproductiva de estas poblaciones aguas arriba de la presa. <strong>Objetivo</strong>. Analizar la viabilidad reproductiva de algunas especies migratorias como <em>Prochilodus magdalenae, Brycon sinuensis</em>, <em>Sorubim cuspicaudus</em> y <em>Pimelodus blochii</em> aguas arriba del embalse de la HU. <strong>Métodos</strong>. Entre abril y octubre 2014, en cuatro sitios: Sambudó (río Sinú), Zancón (río Manso), Beguidó (río Esmeralda) y Dozá (río Verde) se realizaron muestreos de ictioplancton dos veces por semana; se calculó la densidad ictioplanctónica (DI, ict/m<sup>3</sup>); las áreas de desove se estimaron mediante las distancias promedios recorridas por el ictioplancton y la viabilidad de los desoves se evaluó considerando la edad embrionaria en horas posfertilización y el tiempo medio de tránsito para llegar al embalse. Se midieron parámetros fisicoquímicos del agua de los ríos como temperatura, oxígeno disuelto, pH, dureza, alcalinidad, nitritos, nitratos y amonio total amoniacal. <strong>Resultados</strong>. El periodo reproductivo se extendió entre mayo y agosto<ins cite="mailto:N.N" datetime="2016-08-25T13:33">, </ins>observándose la mayor DI y por tanto la mayor actividad reproductiva entre mayo y junio en los ríos estudiados. El río Manso registró la mayor DI (2,4 ict/m<sup>3</sup>) y la menor fue registrada en el río Sinú (0,3 ict/m<sup>3</sup>). En el río Sinú los embriones de <em>P. magdalenae</em> fueron los más abundantes (51,7%), mientras que <em>P. blochii</em> (54%) lo fue en el río Manso. El desarrollo biológico de los embriones se encontró entre blastomeración (66,7%) y faringulación (1,7%). Los desoves provenientes del río Manso son viables ya que eclosionan antes de ingresar al embalse; sin embargo, los desoves provenientes de los ríos Sinú y Verde no se consideraron viables porque llegan al embalse sin haber eclosionado. En el caso del río Esmeralda, cuando los embriones pasan por Beguidó en estado de faringulación es posible su viabilidad. La temperatura osciló entre 27,5°C (Manso) y 24,5 °C (Verde); el oxígeno disuelto estuvo por encima de 8,0 mg/L; pH entre 7,7 (Manso) y 8,7 (Esmeralda); alcalinidad entre 31,1 mg CaCO<sub>3</sub>/L (Manso) y 56,8 mg CaCO<sub>3</sub>/L (Esmeralda); dureza entre 9,3 mg CaCO<sub>3</sub>/L (Manso) y 44,4 mg CaCO<sub>3</sub>/L (Esmeralda). Los nitratos (&lt;0,7 mg/L), nitritos (&lt;0,005 mg/L) y amonio (&lt;0,2 mg/L) fueron bajos. Estas condiciones de calidad de agua en las áreas de desoves naturales, podrían utilizarse como referencia para los procesos de reproducción artificial. <strong>Conclusión.</strong> Los desoves provenientes del río Manso en cualquier estado de desarrollo embrionario son viables<ins cite="mailto:N.N" datetime="2016-08-25T13:35">,</ins> porque eclosionan antes de ingresar al embalse, caso contrario ocurre con los desoves en el río Sinú y en el río Verde.</p><p> <strong>Palabras claves:</strong> Characiformes, desoves, peces migratorios, reproducción, siluriformes</p><p align="center"><strong>VIABILITY OF REPRODUCTIONS FISH MIGRATORY UPSTREAM OF HYDROPOWER URRÁ</strong></p> Víctor J. Atencio-García ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2951 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DE LA VARIABILIDAD GENÉTICA EN UNA POBLACIÓN DEL PECTÍNIDO Argopecten nucleus MEDIANTE MARCADORES MICROSATÉLITES http://revistas.udenar.edu.co/index.php/revip/article/view/2964 <p><strong>Introducción. </strong><em>Argopecten nucleus</em> es un pectínido del Caribe que se cultiva en la Bahía de Taganga (Santa Marta, Colombia), a partir de semilla producida en <em>hatchery</em>.  Su condición de hermafrodita simultáneo con fecundidad externa, baja densidad de sus poblaciones naturales, así como la utilización recurrente de reproductores producidos en <em>hatchery</em> para el mantenimiento de su cultivo, hacen que exista un riesgo de endogamia en las poblaciones naturales y de cultivo.  <strong>Objetivo.</strong> Con el fin de proveer una herramienta molecular que permita estudiar la variabilidad genética de las mismas, en el presente estudio se aislaron y estandarizaron por primera vez, ocho marcadores microsatélites para la especie <em>A. nucleus</em> y con base en estos fue evaluada la variabilidad genética de una población de Bahía Neguanje (Santa Marta, Colombia).  <strong>Métodos.</strong> Para obtener los microsatélites se extrajeron muestras de ADN del músculo aductor (1 cm<sup>2</sup> conservado en etanol al 99%) de 10 ejemplares de <em>A. nucleus</em> (43,6 ± 4,3 mm) producidos en <em>hatchery</em> por fecundación cruzada en el Laboratorio de Moluscos y Microalgas de la Universidad del Magdalena y cultivados en sistema suspendido en la Bahía de Taganga (Santa Marta). A un total de 60 ejemplares silvestres de <em>A. nucleus</em> (41,2 ± 1,8 mm) obtenidos sobre colectores artificiales y cultivados en sistema suspendido en Bahía Neguanje, Santa Marta, se les tomó una muestra de manto (0.5 cm<sup>2</sup>) de la cual se extrajo el ADN siguiendo el protocolo de Lopera et al. (2008), reemplazando el cloruro de sodio por acetato de amonio, para la evaluación de los microsatélites <strong>Resultados:</strong> Se obtuvo una librería genómica con 300 secuencias SSR. Las temperaturas de anillaje (Tm) para los 8 loci con mayor número de repeticiones de nucleótidos oscilaron entre 50,3 y 51,0 °C.  Las frecuencias alélicas variaron entre 0,009 y 0,632, el número de alelos por locus (<em>Na</em>) entre 3 y 8 y la riqueza alélica entre 3,000 y 7,755. La heterocigosidad observada (<em>Ho</em>) varió entre 0 y 0,69, mientras que la esperada (<em>He</em>) estuvo entre 0,527 y 0,786, encontrándose que todos los loci están en desequilibrio Hardy-Weinberg y hay presencia de alelos nulos.  <strong>Conclusiones:</strong> El alto polimorfismo encontrado en los 8 loci aislados, los hace una herramienta potente para su aplicación en estudios de variabilidad genética de poblaciones y análisis de paternidad. Los resultados del uso de estos marcadores sugieren que la población natural estudiada está sujeta a una depresión por consanguinidad, lo que alerta la necesidad de implementar acciones que promuevan el incremento de la variabilidad genética en las poblaciones de cultivo y/o naturales.</p><p> <strong>Palabras clave:</strong> <em>Scallops</em>, ADN, PCR, SSR, estandarización, bivalvo</p><p align="center"><strong>EVALUATION OF GENETIC VARIABILITY IN A POPULATION OF SCALLOPS <em>Argopecten nucleus</em> BY MICROSATELLITE MARKERS</strong></p><p> </p> Judith Barros- Gómez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2964 Tue, 06 Dec 2016 20:36:03 -0500 INDUCCIÓN A LA TRIPLOIDÍA EN EL PECTÍNIDO DEL CARIBE Argopecten nucleus (MOLLUSCA: BIVALVIA). http://revistas.udenar.edu.co/index.php/revip/article/view/2965 <p><strong>Introducción.</strong><em> Argopecten nucleus</em> es un pectínido del Caribe que actualmente está siendo cultivado a escala piloto a partir de juveniles producidos en laboratorio.  Aunque esta especie tiene rápido crecimiento, el tamaño y peso final de sus partes blandas son relativamente bajos.  <strong>Objetivo.</strong>  Evaluar tres métodos para inducir la producción de larvas triploides en <em>A</em>. <em>nucleus</em> y su efecto sobre la supervivencia, desarrollo y crecimiento en las fases larvaria y postlarvaria.  <strong>Métodos.</strong> Se probaron 3 diferentes técnicas de inhibición de la expulsión del segundo cuerpo polar: 1) choques térmicos, 18ºC por 10 min; 2) 6 dimetilaminopurina (6-DMAP), 300 µM L<sup>-1</sup> por 15 min y 3) citocalasina B (CB), 1 mg L<sup>-1</sup> +dimetilsulfóxido (DMSO) al 1% por 15 min, enjuagando con DMSO al 0,1% por 20 min.  Se tuvo un grupo control del CB adicionando solo DMSO y otro grupo control general con cigotos no tratados. <strong> Resultados</strong>. Por primera vez se logró la obtención de larvas triploides de <em>A. nucleus</em>. Se obtuvieron larvas triploides en los tres tratamientos probados pero no en los controles.  Los mayores porcentajes de larvas triploides se presentaron en los cigotos tratados con 6 DMAP (39%) y los menores, aplicando el choque térmico (14%).  Las mayores tasas de desarrollo se presentaron en los en los animales no tratados, mientras que los menores fueron registrados en el tratamiento de CB.  La supervivencia acumulada al final del cultivo larvario fue significativamente menor en las larvas tratadas (10%) que en las no tratadas (52%), siendo especialmente baja en el tratamiento de CB, el cual no logró culminar su desarrollo larval.  Aunque no se encontró una influencia significativa de los tratamientos de inducción a la triploidía sobre el crecimiento en longitud de los embriones y larvas, menores tasas de desarrollo fueron registradas en las larvas tratadas en comparación a las no tratadas, especialmente en el tratamiento de CB.  Luego de 2 meses de asentamiento y cultivo postlarvario, los porcentajes de juveniles recuperados (0,3 y 2,7%) y sus tasas de crecimiento (0,2 y 0,3 mm día<sup>-1</sup>) no estuvieron afectados por los tratamientos de inducción a la triploidía.  <strong>Conclusión.</strong> La inhibición de la expulsión del segundo cuerpo polar en los cigotos de <em>A. nucleus</em> permite la obtención de larvas triploides, pero la longitud y supervivencia no son afectados positivamente por esta manipulación durante las fases larvaria y postlarvaria, por lo que se hace necesaria la evaluación de estas variables en la fase juvenil y adulta.</p><p align="left"><strong>Palabras clave:</strong> Pectínido, 6-DMAP, citocalasina B, choque térmico, supervivencia, crecimiento</p><p align="center"><strong>INDUCTION TRIPLOIDY SCALLOP IN CARIBBEAN </strong><strong><em>Argopecten nucleus</em></strong><strong> (MOLLUSCA: BIVALVIA).</strong></p> Alix Barreto-Hernández ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2965 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE LA DENSIDAD DE SIEMBRA Y DE VARIABLES AMBIENTALES SOBRE ASPECTOS PRODUCTIVOS EN Brycon henni http://revistas.udenar.edu.co/index.php/revip/article/view/2947 <p><strong>Introducción. </strong><em>Brycon henni</em> (sabaleta) es un pez endémico colombiano con problemas de conservación. Se desconocen los efectos de la densidad de siembra y de variables ambientales sobre parámetros productivos en esta especie. <strong>Objetivo.</strong> Evaluar los efectos de la densidad de siembra y variables físico-químicas sobre parámetros productivos en sabaleta. <strong>Métodos.</strong> En la Estación Acuícola John Jairo González del Politécnico Colombiano JIC en San Jerónimo, Antioquia, se obtuvieron crías de sabaleta a partir de reproductores locales, y se les evaluaron mensualmente longitud y peso durante 14 meses. <strong>Resultados.</strong> Se encontraron correlaciones negativas (17 y 29%) entre altas densidades de siembra y ganancia de peso (postlarvas y alevinos, 200 y 104 animales/m2 respectivamente). Bajas densidades de siembra (25 animales/m2) tuvieron efectos sobre juveniles (entre 8,8 y 10,20 g) (86%) pero no sobre dedinos (26%). Se determinaron correlaciones negativas (60 y 33%) entre la temperatura promedio (23,6ºC) y crecimiento larvario y postlarvario, respectivamente. Para alevinos y dedinos, las correlaciones entre temperatura del agua (25,5 y 25,0ºC) y crecimiento fueron bajas (10 y 25%, respectivamente). El crecimiento en juveniles tuvo una baja correlación (39%) con la temperatura (25,5ºC). Los valores de pH fueron entre neutros y básicos para todos los estadíos evaluados (7,3-8,4), y tuvieron bajas correlaciones (30% y 11%, respectivamente), con el crecimiento de alevinos y juveniles. Se hallaron correlaciones negativas entre conductividad del agua y crecimiento para larvas y postlarvas (42 y 18%), y positivas para dedinos y juveniles (22 y 15%). Para sólidos disueltos totales, las correlaciones fueron bajas (larvas y postlarvas,  50 y 21%; dedinos y juveniles, 25 y 12%). La ganancia de peso tuvo tendencia al alza a medida que los animales crecían, aunque con pérdidas de peso leves (0.41, 1.54, 2.38 g) en las edades de 284, 358 y 488 días, respectivamente, posiblemente  relacionadas con los niveles de lluvia reportados para dichas épocas (96, 56, y 68 mm). El modelo de von Bertalanffy evaluó la relación alométrica ente el peso y el tiempo (estadíos), mostrando que a medida que se incrementaba la edad se incrementaban también la  longitud y el peso de las sabaletas (correlaciones de 89,8% y 91,7%, respectivamente) (R<sup>2</sup>=0,93; P&lt;0.00). Asimismo, el análisis de varianza para la regresión fue altamente significativo (F=6575; P&lt;0,00). <strong>Conclusión.</strong> Se recomienda realizar ensayos de siembra a bajas densidades y controlar la temperatura y los sólidos totales, dado que altas concentraciones de estos especialmente en los periodos de lluvia afectan la capacidad de los peces para realizar intercambio gaseoso eficiente en las etapas iniciales de crecimiento, gastando energía para su respiración, con detrimento en la ganancia de peso. Se confirma que la longitud y el peso son buenos estimadores de la edad de los peces bajo estudio, y que cambios en  parámetros físico-químicos del agua pueden afectar su desarrollo.</p><p> <strong>Palabras clave:</strong> peces endémicos, conservación, densidad de siembra, parámetros físico-químicos. </p><p align="center"><strong> </strong></p><p align="center"><strong>EFFECTS OF STOCKING DENSITY AND ENVIRONMENTAL PARAMETERS ON PRODUCTIVE ASPECTS IN <em>Brycon henni</em></strong><strong><em></em></strong></p> Lucy Arboleda-Chacón ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2947 Tue, 06 Dec 2016 20:36:03 -0500 APRENDER HACIENDO COMO ESTRATEGIA PARA EL CONOCIMIENTO DE LA CALIDAD DE AGUA EN ESTANQUES PISCÍCOLAS-IALL http://revistas.udenar.edu.co/index.php/revip/article/view/2953 <p class="Default"><strong>Introducción.</strong> El entendimiento de la calidad del agua en piscicultura es fundamental para el desarrollo exitoso de la producción. En el instituto de acuicultura de los Llanos-IALL, de Unillanos, se han llevado a cabo en el curso de piscicultura desde el año 2006, prácticas de campo y laboratorio, las cuales se basan en una experiencia, trayendo a colación conceptos, procedimientos, métodos e instrumentos, que permiten su ejecución, apoyando los cursos de pregrado en áreas agropecuarias e integrando estrategias para lograr el proceso de enseñanza y aprendizaje, fortaleciendo las competencias cognitivas y praxiológicas en el campo específico de calidad de agua. <strong>Objetivo. </strong>Analizar la tendencia comportamental de los parámetros <em>in situ</em> de calidad de agua en estanques del IALL. <strong>Métodos. </strong>El IALL está localizado a 7 km de Villavicencio vía Puerto López, en el Meta, esta revisión se desarrolló sobre una base de datos compilada y analizada de modo que permitiera presentar la información registrada de monitoreamiento semestral de parámetros <em>in situ </em>de calidad de agua, por estudiantes de Medicina Veterinaria y Zootecnia y Licenciatura en Producción Agropecuaria del curso de piscicultura a través de los diferentes semestres de enseñanza. Las determinaciones <em>in situ</em> de parámetros como: temperatura, oxígeno disuelto, porcentaje de saturación de oxígeno, conductividad, sólidos totales (YSI profesional Plus) y transparencia fueron realizadas, después de la explicación teórica, en tres puntos del estanque (entrada, centro y salida) seleccionado por el grupo estudiantil de cada corte. Se seleccionaron cinco estanques con muestreos durante tres semestres, como mínimo y complementando con información del año 2016. <strong>Resultados. </strong>El desarrollo de prácticas estandarizadas mediante la metodología "aprender haciendo", genera acopio de información confiable para interpretaciones a corto, mediano y largo plazo.<strong> </strong>En términos generales,<strong> </strong>la transparencia fue el parámetro con mayor<strong> </strong>variación (±5 cm) entre puntos<strong> </strong>en un mismo estanque, independiente del tiempo de muestreo. La temperatura tendió a aumentar (0,5°C) del primero al segundo semestre del mismo año muestreado. El pH fue el parámetro más estable entre puntos del estanque en un mismo muestreo, sin embargo entre muestreos, fue el parámetro con mayor amplitud, así: 5,8-7,6; 4,8-6,6; 5,0-8,1; 5,7-6,9 y 6,4-10 en los estanques del 1 al 5 respectivamente. Ya en los sólidos y conductividad no se vislumbró un comportamiento secuencial. El oxígeno disuelto estuvo en el rango de confort (4,1 a 8,5 mg/L) en tres de los cinco estanques, durante los tiempos de muestreo y los dos restantes presentaron durante un semestre valores atípicos (3,2 y 9,7 mg/L). El 75% de las correlaciones entre oxígeno y transparencia no fueron significativas (R&lt;0,74). C<strong>onclusión. </strong>El desarrollo de<strong> </strong>prácticas estandarizadas mediante<strong> </strong>estrategias pedagógicas, además de contribuir a la formación de los estudiantes permite la estructuración del acervo de parámetros  de calidad de agua para interpretación y toma de decisiones.</p><p class="Default"><strong>Palabras clave:</strong> conductividad, oxígeno disuelto, pH, sólidos, temperatura, transparencia</p><p align="center"><strong>LEARNING BY DOING A STRATEGY FOR THE KNOWLEDGE ON WATER QUALITY IN FISH PONDS-IALL</strong><strong></strong></p> Cristian Antonio Ruiz-Ramirez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2953 Tue, 06 Dec 2016 20:36:03 -0500 ÍNDICES CORPORALES DE CACHAMA BLANCA Piaractus brachypomus CULTIVADAS EN BIOFLOC (BFT) http://revistas.udenar.edu.co/index.php/revip/article/view/2957 <p><strong>Introducción. </strong>El cultivo BFT tiene ventajas al mantener la calidad del agua con poco recambio y ofrecer una fuente de proteína de origen microbiano. Sin embargo, surgen preguntas respecto a las condiciones fisiológicas que los peces exhiben en este sistema. En razón a lo anterior, la pregunta es cómo serán los índices corporales de cachamas blancas criadas en BFT. <strong>Objetivo. </strong>Determinar los índices corporales de cachama blanca en un sistema BFT alimentadas con dietas experimentales con diferentes fuentes de proteína.<strong> Método</strong>. Para la evaluación fueron empleados tres tratamientos: T1: BFT + alimento del 24% de Proteína cruda (PC) de origen vegetal; T2: BFT+ alimento del 24% de PC con 5% de Harina de pescado; T3: BFT + alimento del 24% de PC con 5% de harina de espirulina, allí los peces fueron alimentados tres veces al día hasta saciedad aparente y el biofloc se mantuvo una relación C:N de 15:1, sombrío del 80% y coloración marrón. Cada tratamiento tuvo tres replicas para un total de 9 unidades experimentales, contenida cada una en un tanque de 500 L, en cada tanque se sembraron 42 peces (54,5±5,8 g) y se cultivaron durante 84 días. El sistema se operó con aireación por blower y temperatura constante. El día final de cultivo, se sacrificaron 10 peces por tanques y se determinaron los índices: Factor de condición (K), Índice viscerosomático (IVS), Índice hepatosomático (IHS), Índice de grasa corporal (IGC) y la Relación entre la longitud estándar y la Longitud intestinal total (RLELI). <strong>Resultados</strong>. K osciló entre 4,76 y 4,85 (4,8±0,33); IVS osciló entre 8,6 y 9,2 (8,7±1,7); IHS estuvo entre 1,5 y 1,7 (1,62±0,5); IGC osciló entre 2 y 2,17 (2,1±0,7) y RLELI estuvo entre 1,57 y 1,7 (1,1±0,2). No se encontró diferencia estadística entre tratamientos para ninguno de los índices. <strong>Conclusión</strong>. La fuente de proteína en la dieta de cachamas blancas cultivadas en BFT no generó cambios en sus índices corporales.</p><p><strong>Palabras clave</strong>: Factor de condición, Índice viscerosomático, Indice hepatosomático, Índice de grasa corporal, Relación Longitud corporal: Longitud intestinal</p><p align="center"><strong>BODY INDICES OF CACHAMA BLANCA <em>Piaractus brachypomus</em> REARING IN BIOFLOC (BFT)</strong></p><p> </p> Sandra Pardo-Carrasco ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2957 Tue, 06 Dec 2016 20:36:03 -0500 INFLUENCIA DE LA TEMPERATURA Y EL FOTOPERIODO SOBRE LAS VARIABLES PRODUCTIVAS DEL CLADOCERO Moina sp. http://revistas.udenar.edu.co/index.php/revip/article/view/2959 <p><strong>Introducción. </strong>El subdesarrollado tracto intestinal y el diámetro bucal de las larvas de peces impiden que estas puedan ser alimentadas con dietas artificiales. El alimento vivo, es una fuente de alimento alternativa en la etapa larval, calificada como crítica por la baja tasa de sobrevivencia. Dentro del zooplancton los cladóceros son un grupo de organismos diversos, poseen rápido desarrollo, son presa fácil, poseen gran variedad de enzimas digestivas y nutrientes esenciales. Estas características están influenciadas por la calidad del alimento proporcionado, la temperatura, el pH y la salinidad del agua y el fotoperiodo. <em>Moina sp., </em>es una especie de cladócero de importancia para la acuicultura, su cultivo a escala comercial es limitado y existen pocos reportes sobre la evaluación de las condiciones óptimas para obtener una producción constante y de calidad. <strong>Objetivo. </strong>Determinar la influencia del fotoperiodo y la temperatura en las principales variables productivas del cladócero <em>Moina sp. </em><strong>Métodos. </strong>Adultos inmaduros de <em>Moina sp.,</em> fueron sembrados en frascos de vidrio con un volumen útil de 400 ml, a una densidad inicial de 0,0625 individuos/ml<sup>-1</sup>, se alimentaron con <em>Desmodesmus opoliensis</em>, a una concentración de 2.075 x 10<sup>6</sup>células/ml. Se instauraron seis tratamientos con tres replicas,  los tratamientos uno, dos y tres se mantuvieron aislados en cabinas proporcionando un fotoperiodo de  veinticuatro, cero y doce horas de luz respectivamente y una temperatura constante de 20°C; los tratamientos cuatro, cinco y seis, se mantuvieron aislados en las mismas condiciones de fotoperiodo con una temperatura promedio de 28°C. La densidad poblacional se determinó diariamente, durante diez días. Posteriormente se evaluaron las variables: Tasa Instantánea de Crecimiento/días (TCE), Rendimiento Ind/ml<sub>/</sub>día<strong> (</strong>R), Tiempo de Duplicación/días (TD), Densidad máxima Ind/L(Dm), Día de máxima densidad/días (Dmd) y Densidad Final Ind/ml (DF). Se realizó ANOVA no paramétrica mediante test de kruskal-wallis y comparación múltiple de Dunn´s. <strong>Resultados.</strong> El tratamiento seis presentó una mayor TCE (p&lt;0,05) (0,17 ± 0,02) comparado con el tratamiento cinco (0,04 ± 0,01). Obtuvo un R de (0,03 ± 0,007) (p˃0,05) muy similar a los demás tratamientos. El TD fue mayor para el tratamiento cinco (18,8 ± 5,37), sin embargo, no presentó diferencias significativas (p˃0,05) con los demás tratamientos, el Dmd fue el día décimo para todos los tratamientos excepto para el tratamiento cuatro y cinco que fue el día octavo, la Dm fue mejor para el tratamiento seis (363,3 ± 78,81) sin presentar diferencias significativas (p˃0,05) con los demás tratamientos. En cuanto a la DF fue mayor (p&lt;0,05) en el tratamiento seis (0,36 ± 0,07) comparado con el tratamiento cinco (0,10 ± 0,01).<strong> Conclusión. </strong>La temperatura y el fotoperiodo no influyeron significativamente en las variables productivas del cultivo <em>Moina sp., </em>sin embargo el tratamiento seis, mostró el mejor desempeño productivo y el tratamiento cinco presento el más bajo desempeño productivo.<strong></strong></p><p><strong> </strong><strong>Palabras clave: </strong>alimento vivo, Zooplancton, Cultivo, Larvas de peces</p><p class="MsoNormal" style="text-align: center;" align="center"><strong><span style="font-size: 12.0pt; font-family: 'Times New Roman','serif'; color: #222222;">INFLUENCE OF TEMPERATURE AND PHOTOPERIOD ON VARIABLES PRODUCTIVE OF CLADÓCERO <em>Moina sp.</em></span></strong><strong><em></em></strong></p><span style="font-size: 12.0pt; font-family: 'Times New Roman','serif'; mso-fareast-font-family: Calibri; mso-ansi-language: EN-US; mso-fareast-language: EN-US; mso-bidi-language: AR-SA;" lang="EN-US">live feed, Zooplankton, Culture, Fish larvae</span> Cesar R. Morales-Contreras ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2959 Tue, 06 Dec 2016 20:36:03 -0500 COMPARACIÓN DEL CRECIMIENTO EN CAUTIVERIO DE DOS ESPECIES DE LUTJÁNIDOS http://revistas.udenar.edu.co/index.php/revip/article/view/2961 <p><strong>Introducción.</strong> Las actividades de explotación petrolera en el Golfo de México han reducido sensiblemente las áreas de pesca costera para las cooperativas, por lo que se hace necesario encontrar alternativas económicas para la sobrevivencia de los pescadores. Con esta intención, se han venido probando diversas especies susceptibles de cultivo para ser incorporadas a la acuicultura. <strong>Objetivo</strong>. Identificar la velocidad de crecimiento en longitud y peso de dos especies de pargo para determinar la factibilidad de incorporarlas a la acuicultura en una zona costera de Tabasco. <strong>Método</strong>: A partir de ejemplares silvestres colectados en las costas de Paraíso, Tabasco, se conformaron lotes de dos especies de pargos (<em>Lutjanus griseus</em> y <em>L. analis</em>) para evaluar sus tasas de crecimiento en longitud y peso. Dichos lotes se establecieron en la Estación de Acuicultura Marina (EAM) de la División Académica de Ciencias Biológicas (DACBiol) de la Universidad Juárez Autónoma de Tabasco (UJAT). Se realizó el protocolo de cuarentena de los peces agregando neguvón® para eliminar ectoparásitos e inyectando a cada pez con L-Eticina® para ayudar a la cicatrización de heridas causadas durante la colecta y/o transporte.<em> </em>Los peces se colocaron en agua salobre a 12 UPS por especie y por lote, en tanques de 4 m de diámetro. Los peces se alimentaron a saciedad tres veces al día usando alimento para peces marinos marca Skretting® y/o alimento para trucha marca el Pedregal®, dependiendo de la disponibilidad. A cada lote de peces se les realizaron biometrías mensualmente, registrando el  peso y la longitud total de todos los peces de cada lote, usando como anestésico 5 gotas de aceite de clavo por ml de agua. También se realizaron recambios totales de agua 3 veces por semana y diariamente se registraron el pH, la salinidad y el oxígeno disuelto. Los nitratos, los nitritos y el amonio se registraron una vez por semana. <strong>Resultados</strong>: De octubre de 2015 a mayo de 2016, la longitud promedio de <em>L. griseus </em>pasó de 12,64 +/-1,8 a 24,41+/-2,4 cm y su peso 24.50+/-2,5 a 185,52+/-1,96 ganando 11,77 cm  y 161,02 g; en  <em>L. analis</em> varió 26,97+/-2,32 a 36,94+/- cm y su peso de 278,63 a 443,50 g, con una ganancia de 9,97 cm y 164,87g. La sobrevivencia fue de 76,92% y 26,6% respectivamente. <strong>Conclusión</strong>: En lo que respecta al crecimiento, ambas especies tienen un comportamiento similar, por lo que la elección de la especie más adecuada para el cultivo dependerá de otros parámetros como la sobrevivencia que fue mayor para <em>L. griseus</em>.</p><p><strong>Palabras clave</strong>: Lutjanidae, pargos, crecimiento, factibilidad de cultivo</p><p> </p><p align="center"><strong>COMPARISON OF GROWTH IN CAPTIVITY OF TWO SPECIES OF SNAPPER</strong></p><p align="center"> </p> María L. Salvadores-Baledón ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2961 Tue, 06 Dec 2016 20:36:03 -0500 RESULTADOS PRELIMINARES DEL DESEMPEÑO PRODUCTIVO DE DONCELLA Ageneiosus pardalis LUTKEN, 1874 EN ESTANQUES EN TIERRA http://revistas.udenar.edu.co/index.php/revip/article/view/2966 <p><strong>Introducción. </strong>La demanda de carne de pescado para consumo humano y la disminución del recurso íctico en ambientes naturales, crea la necesidad de avanzar en el desarrollo de tecnologías de cultivos de nuevas especies y de generar  información biológica básica y de producción para su conservación. La doncella, <em>Ageneiosus pardalis</em>, es una especie de amplio aprovechamiento comercial en la cuenca del río Magdalena, de hábitos migratorios que la hacen susceptible a la pesca y hábitos carnívoros que dificultan su producción en cautiverio. En la actualidad existe una marcada declinación de sus volúmenes de captura y está catalogada como una especie vulnerable a extinción. <strong>Objetivo</strong>. Conocer el desempeño productivo de la doncella <em>A. pardalis</em> en estanques en tierra. <strong>Métodos. </strong>En la Estación Piscícola San Silvestre Barrancabermeja-Santander se llevó a cabo, durante 240 días, el seguimiento del desempeño productivo de <em>A. pardalis</em> en estanques en tierra de 50 m<sup>2</sup>, cubiertos de geomembrana. Se utilizaron 171 alevinos de doncella, obtenidos por reproducción artificial en la misma estación, con longitud total y peso inicial promedio de 12,7±1,5 cm y 13,7±3,9 g respectivamente. Los alevinos fueron distribuidos en tres estanques a una densidad de 1,1 individuos/m<sup>2</sup>. La alimentación se realizó con alevinos de tilapia roja y alimento comercial de 34% PB. Se suministraron aproximadamente 300 alevinos semanales (100 g de biomasa) por estanque y una ración diaria de alimento comercial, la cual se inició con el 8% de la biomasa total y se disminuyó gradualmente hasta finalizar con el 3%. Cada 30 días se muestrearon 15 peces por estanque, registrándose los valores de longitud total y peso total. También se registraron valores de oxígeno disuelto (OD), temperatura (T) y pH tomados una vez al día, entre las 9 y 11 am.  Los resultados son expresados en promedios ± desviación estándar de las tres unidades experimentales. <strong>Resultados</strong>. Los registros de calidad de agua fueron: T=30,6±1,3°C; OD=3,8±1,2 mg/L y pH=7,7±0,7 unidades. La longitud total promedio al final del experimento fue de 22,5±0,7 cm y el peso total promedio fue de 72,1±3,6 g. Los valores promedios de ganancia diaria de peso, tasa específica de crecimiento, ganancia en biomasa y factor de condición fueron 0,24±0,2 g/día; 0,56±0,20 %/día; 3,3±0,4 Kg y 0,84±0,05 respectivamente; la sobrevivencia fue de 80,7±12,3%. <strong>Conclusión</strong>. Durante el experimento se evidenció que la doncella consumió alimento comercial en las tres unidades experimentales, lo cual hace factible el cultivo de esta especie en estanques en tierra y la posibilidad de introducirla a los sistemas de producción acuícola nacional. Lo anterior permite afirmar que con buen manejo técnico se puede lograr altas sobrevivencias y plantear programas de repoblamiento para su conservación.  </p><p><strong>Palabras clave</strong>: cultivo peces, piscicultura, alimento comercial, siluridae, peces forrajeros</p><p align="center"><strong><span lang="EN-US">Preliminary results of Doncella </span><em><span lang="EN-US">Ageneiosus pardalis</span></em><span lang="EN-US"> farming in earthen ponds</span></strong><strong></strong></p> Diana luz Madariaga-Mendoza ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2966 Tue, 06 Dec 2016 20:36:03 -0500 DESEMPEÑO PRODUCTIVO DEL POLICULTIVO Macrobrachium sp y Oreochromis sp EN UN SISTEMA CERO RECAMBIOS TIPO “BIOFLOC” http://revistas.udenar.edu.co/index.php/revip/article/view/2967 <p>La acuicultura en aguas continentales es una actividad productiva en desarrollo y sirve como sustento alimenticio y económico para muchas poblaciones rurales en Ecuador. Sin embargo, esta actividad se desarrolla con un mínimo número de especies acuáticas; por tal motivo, la presente investigación busca diversificar la producción acuícola mediante el policultivo de tilapia (<em>Oreochromis </em>sp) y camarón de río (<em>Macrobrachium </em>sp), con un enfoque a una producción sostenible, controlando la dinámica de los factores, en un sistema de cero recambios de agua, “Biofloc”. Este tipo de tecnología aprovecha todos los residuos y microorganismos del medio, convirtiéndolos en bioflóculos, siendo estos pequeños agregados de fitoplancton, zooplancton, bacterias, heces y residuos de alimento; y que posteriormente se convertirán en fuente alimenticia de alto valor nutricional. <strong>Metodología</strong>: El trabajo se desarrolló en el invernadero cuarentenario de la ESPE, a una altitud de 2840 m. Los factores a probar fueron: carga animal (monocultivo y policultivo) y sistema de producción (tradicional y biofloc), en donde el número de organismos para camarón y tilapia fueron de162 y 72 unidades respectivamente, manteniendo una proporción en policultivo de 7:3, entre camarón y tilapia. Previo al desarrollo del ensayo y para los tratamientos en “Biofloc”, se maduró un macrocosmos a base de melaza, microalgas, probióticos y fertilizantes. Los parámetros físico-químicos y microbiológicos del agua fueron evaluados diariamente, mientras que los morfométricos y productivos cada 15 días. <strong>Resultados: </strong>Durante los 42 días del ensayo los parámetros ambientales no presentan diferencias estadísticas entre tratamientos (p&gt;0,05), manteniendo rangos estables durante el cultivo: temperatura 22±2°C; pH 8,29 ±0,19, sólidos 116±28,4 y oxígeno disponible de 4,57±0,32 ppm. El crecimiento de bioflóculos detecta diferencias entre tratamientos (p&lt;0,05), con un mayor contenido de los agregados en policultivo (17,12 ml/L). Las biomasas finales en los dos sistemas de policultivo tilapia: camarón, no presentan diferencias estadísticas (p&gt;0,05), sin embargo los monocultivos entre las mismas especies detectan diferencias (p&lt;0,05) y un crecimiento importante en tilapia en biofloc. <strong>Conclusión</strong>: La implementación de sistemas “biofloc” en cultivos acuícolas es viable por la productividad alcanzada en policultivos y la estabilidad de los factores ambientales, generando un ahorro de energía mediante la eficiente utilización del agua de cultivo para producción.</p><p><strong>Palabras claves</strong>: policultivo, <em>Orechromis</em> sp, camarón de río, biofloc</p><p align="center"><strong>PRODUCTIVE PERFORMANCE POLYCULTURE <em>Macrobrachium</em> sp AND <em>Oreochromis</em> sp, IN BIOFLOC SYSTEM </strong></p> Samira Reinoso ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2967 Tue, 06 Dec 2016 20:36:03 -0500 PRODUCCIÓN DE TILAPIA (Oreochromis sp.) EN SISTEMA BIOFLOC: ESTIMACIONES EN EL PERFIL DE ÁCIDOS GRASOS http://revistas.udenar.edu.co/index.php/revip/article/view/2969 <p><strong>Introducción:</strong> los sistemas Biofloc, operan bajo una rápida acumulación de residuos, sin embargo con el desarrollo de microorganismos heterotróficos en los flocs se ayuda en la remoción de los desechos de materia orgánica e inorgánica de la columna del agua y además sirven de fuente de alimento vivo. El uso de los sistemas Biofloc, pueden afectar la calidad nutricional en el filete de los peces, promoviendo el aumento de ciertos niveles de ácidos grasos. <strong>Objetivo: </strong>comparar el perfil de ácidos grasos en filetes de tilapia cultivada en sistemas Biofloc y en recirculación. <strong>Metodología:</strong> el ensayo se llevó a cabo en la estación piscícola de la Corporación Universitaria Lasallista, los tratamientos se distribuyeron así, dos tanques con BFT y dos tanques con RAS, se sembraron peces con un peso promedio de 17,35 gramos/pez, una densidad de 28 peces/m3, la tasa de alimentación fue del 10% de la biomasa y se ajustó cada 15 días con el pesaje, el porcentaje de proteína de la dieta fue del 38% y la relación C/N en el biofloc se mantuvo con la incorporación de melaza cada dos día.  El ensayo duro 60 días, al final del mismo se sacrificaron 12 peces por tanque,  a los cuales se les realizaron perfiles de AG en sus filetes (DHA, EPA, grasa  mono y poli insaturadas, saturadas; total, cis, trans y omegas). <strong>Resultados:</strong> los resultados obtenidos evidenciaron que no hubo diferencias estadísticamente significativas (p&gt;0,05) entre uso de sistemas biofloc y de recirculación convencional, respecto a la calidad nutricional de los filetes de tilapia. <strong>Conclusiones</strong>: la producción de tilapia roja, haciendo uso de sistemas Biofloc no tiene efecto sobre la relación de AG en los filetes, aun cuando presenta todos los AG importantes, mostrando que la calidad nutricional de tilapia es igual a la calidad obtenida en sistemas de recirculación convencional.</p><p> <strong>Palabras clave:</strong> pez, agua, microorganismos, consumo, calidad - MeSH</p><p><strong>PRODUCTION OF TILAPIA (<em>Oreochromis sp</em>.) IN BIOFLOC SYSTEM: ESTIMATES IN THE PERFIL DE FATTY ACID</strong></p> Victoria Atehortua ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2969 Tue, 06 Dec 2016 20:36:03 -0500 CONTROL DE INYECCIÓN DE CO2 A TRAVÉS DEL PH DEL CULTIVO DE MICROALGAS Isochrysis galbana http://revistas.udenar.edu.co/index.php/revip/article/view/2971 <p><strong>Introducción.</strong> Las microalgas aún siguen siendo de gran importancia dentro de la acuicultura, y aunque su cultivo está bien establecido, existe la tendencia a intensificar y automatizar su producción cada vez más. Unos de los métodos para incrementar la producción de las microalgas es el enriquecimiento del cultivo con dióxido de carbono, no obstante, la forma de aplicación así como la cantidad necesaria no es del todo clara. Es por ello que se estudió el control del pH del cultivo de la microalga marina <em>Isochrysis galbana</em>, como estrategia para desarrollar un método de inyección de CO2 al cultivo. Adicionalmente se desarrolló un sistema automático de inyección basado en “Arduino”, el cual facilite establecer la cantidad y frecuencia de inyección de CO2 al cultivo de microalgas. <strong>Objetivo.</strong> Evaluar el efecto de la disminución del pH del agua con CO2 sobre la producción de la microalga <em>Isochrysis galbana</em>.<strong> Metodología</strong>. Se realizó un experimento en el cual, se disminuyó el pH del cultivo de la microalga <em>I. galbana</em>, utilizando inyección de CO2 como enriquecedor de fuente de carbono. Para ello se realizaron tres tratamientos por triplicado, utilizando recipientes de vidrio transparentes de 3 L, se les suministró aireación constante y fotoperiodo de 24 h. El medio de cultivo utilizado fue F/2. Los tratamientos fueron disminuciones del pH utilizando CO2 así, T1: disminución del pH entre 7 y 7,5,  T2: disminución del pH entre 6 y 6,5, T3: disminución del pH del agua entre 5 y 5,5. La inyección se realizó tres veces al día (08:00, 12:00 y 16:00). Adicionalmente se utilizó un control sin adición de CO2. En base a los resultados se diseñó un sistema electrónico basado en Arduino, el cual permitirá automatizar el suministro de fuente de carbono. <strong>Resultados. </strong>Se encontró que el pH del cultivo generado por las diferentes cantidades de inyección del dióxido de carbono, no generó diferencias significativas (p&gt;0.05) en cuanto al crecimiento de la cepa <em>I. galbana</em> (24,1; 25,6; 24,4 x 10<sup>6</sup> cel.ml<sup>-1</sup>, para T1, T2 y T3, respectivamente). No obstante, en todos los casos la densidad celular fue superior (p&lt;0.05) con suministro de CO2 que en con el grupo control (16,9 x 10<sup>6</sup> cel.ml<sup>-1</sup>). <strong>Conclusión.</strong> La cantidad de CO2 a inyectar al cultivo de la microalga <em>I. galbana</em>, tiene un efecto sobre el crecimiento de la microalga estudiada. Para ello el sistema de control de pH automático se plantea como una herramienta factible para el control de la inyección de CO2, en el cual el parámetro de control se deberá fijar entre 7 y 7,5. Este diseño no solo facilitará el suministro, sino que también ahorrará el consumo de dióxido de carbono en cultivos intensivos de la microalga <em>I. galbana</em>.<strong> </strong></p><p><strong>Palabras clave: </strong>producción, alimento vivo, fitoplancton, acuicultura</p><p align="center"><strong>CONTROL OF CO2 INYECTION THROUGH THE CULTURE PH of <em>Isochrysis</em> <em>galbana</em> MICROALGAE </strong></p><p> </p> Gustavo Adolfo Torres-Valencia ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2971 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN DE LA PRIMERA ALIMENTACIÓN DE BOCACHICO Prochilodus magdalenae UTILIZANDO MACROAGREGADOS DE FLOC http://revistas.udenar.edu.co/index.php/revip/article/view/2946 <p><strong>Introducción. </strong>Bocachico <em>Prochilodus magdalenae </em>es la principal especie de importancia en la piscicultura extensiva colombiana que no depende de los alimentos comerciales para su cultivo. La demanda de alevinos de esta especie se ha incrementado en los últimos quince años tanto para fines de repoblamiento como para cultivos extensivos. En el manejo de la primera alimentación de esta especie se ofrece alimentos vivos como naúplios de artemia recién eclosionados y zooplancton silvestre; sin embrago, aún no se ha evaluado el uso de macroagregados del floc con su fauna acompañante (rotíferos, naúplios de copépodos y vorticelas) como primer alimento para esta especie. <strong>Objetivo</strong>. Evaluar el manejo de la primera alimentación de Bocachico con macroagregados de floc. <strong>Materiales y métodos. </strong>En la Estación Piscícola de Repelón de la AUNAP (EPR, Atlántico), bajo un diseño enteramente casualizado con tres réplicas por tratamiento, se instalaron 12 recipientes plásticos con volumen útil de 30L y aireación constante, en los cuales se sembraron 9000 larvas de bocachico (25larvas/L) alimentadas dos veces al día durante cinco días con macroagregados de floc a razón de 5 ml/L (T1), macroagregados de floc (5 ml/L)+zooplancton silvestre de 200-400µm (5 ind/ml) (T2), macroagregados de floc (5 ml/L)+naúplios de artemia (5 ind/ml) (T3). Los macroagregados del floc se formaron a partir del inóculo de bacterias (autótrofas y heterótrofas) contenidas en una muestra de agua procedente de un estaque de la EPR, la muestra se diluyó en agua lluvia filtrada almacenada en un tanque con capacidad útil de 200L y acondicionado con aireación permanente; a esta solución se le agregó, como fuente de nitrógeno, cloruro de amonio y como fuente de carbono, melaza y harina de yuca, además se adicionó bicarbonato de sodio para mantenimiento de la alcalinidad. Los principales parámetros de calidad de agua fueron controlados y al final del manejo de la primera alimentación ensayo se estimó la ganancia en peso (Gp), ganancia en longitud (Gl), tasa específica de crecimiento (G), sobrevivencia (S) y resistencia al estrés (RE). <strong>Resultados. </strong>La Gl osciló entre 0,42±0,14 mm (T2) y 0,45±0.12 mm (T3) sin observarse diferencia estadística (p&gt;0,05). Las mayores Gp y G se registraron en T2 (Gp = 0.66±0.10 g, G = 12,4±1,33 %/día) y T3 (Gp = 0,60±0,03 g, G = 11,6±0,37 %/día) sin diferencia significativa entre estos tratamientos. La mayor sobrevivencia (37,2±1,5%) y calidad larvaria (RE = 82,3±8,2%) se registraron en T3 siendo estadísticamente diferente a los demás tratamientos (p&lt;0,05). <strong>Conclusión. </strong>El uso de macroagregados del floc es una alternativa viable para el manejo de la primera alimentación de<em> P. magdalenae.</em></p><p><strong>Palabras clave: </strong>biofloc, naúplios de artemia, larvicultura, zooplancton </p><p align="center"><strong>EVALUATION OF THE FIRST FEEDING OF BOCACHICO <em>Prochilodus magdalenae</em> USING FLOC MACROAGGREGATES</strong></p> Vicente Pertúz-Buelvas ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2946 Tue, 06 Dec 2016 20:36:03 -0500 CARACTERIZACIÓN BROMATOLÓGICA DE RECURSOS VEGETALES DE LA REGION PACIFICO COLOMBIANO PARA ALIMENTACIÓN DE PECES http://revistas.udenar.edu.co/index.php/revip/article/view/2952 <p><strong>Introducción</strong>. La alta biodiversidad del Pacifico Colombiano contrasta con el desconocimiento que se tiene sobre las especies de flora y fauna presente en este territorio; al borde de los río florecen innumerables árboles, arbustos y forrajes que al ritmo de las aguas van entregando sus flores, frutos, hojas y raíces a una comunidad de peces moluscos, crustáceos microorganismos e insectos, que en conjunto es lo que permite que la vida se esté renovando constantemente. <strong>Objetivo</strong>. Identificar los recursos locales aptos para la alimentación de peces, que permitan reducir los costos de producción o mejorar los procesos de crecimiento y reproducción. <strong>Métodos</strong>. La investigación se desarrolló en las comunidades de Sabaletas (3°59´59.17´´N – 76°58´26´´ O, 29 msnm), San Marcos (3°42´22.97´´N – 76°57´57´. O, 39 msnm) y Bajo Calima (3°44´34.15´´ N – 76°57´53´´ O, 59msnm) del Distrito de Buenaventura,  Valle del Cauca Colombia. Se recolectó información con pobladores de la cuenca baja de los ríos Anchicayá y Calima, mediante realización de 20 encuestas y 20 entrevistas guiadas, a partir de las cuales se obtuvo la información necesaria para la recolección de muestras de las plantas reportadas. Posteriormente se elaboró y analizó el número de reportes para cada una de las plantas a estudiar. El análisis bromatológico se realizó en los laboratorios de la Universidad Nacional de Colombia, sede Palmira. <strong>Resultados</strong>. Se identificaron 20 recursos de los ríos Anchicaya y Calima, priorizando el tangare, guayabillo, matapalo, naydi, cacao de monte, coronillo, papa china, paco, yarumo, chipero, árbol del pan, pomarrosa y coronillo.  De acuerdo con el porcentaje de reportes hechos por los pobladores, el chontaduro representó un 16% de los reportes, seguido por la bagata, 14%, palma africana 12%, bacao 12% y chipero 9%; las demás especies representaron entre un 2 y 5% de reportes. Los resultados de composición bromatológica se presentan en nutrientes porcentuales en base seca. La papa china, la pomarrosa, el coronillo y el árbol del pan presentaron altos contenidos de carbohidratos totales de 85,3%, 56,91%, 60,2% y 46,33% respectivamente, en tanto que el chipero, el pacó, yarumo y coronillo presentaron los mayores contenidos protéicos 22,24%, 16,72%, 14,2% y 12,65% respectivamente. Con relación a la lignina se encontraron los mayores valores para el yarumo 26,06%, el chipero 21,21% y el coronillo 20,9%, mientras que la papa china, el árbol del pan y el pacó presentaron los menores valores, con 1,28%, 2,48% y 3,63% respectivamente. <strong>Conclusión</strong>. Se identificaron 20 especies vegetales que son consumidas por los peces en los ríos, 4 de ellas se destacan  por los aportantes de carbohidratos (papa china, coronillo, pomaroso y árbol del pan) y 2 por el aporte de proteína (chipero y pacó); Por su contenido de nutrientes poseen potencial para la alimentación de peces.</p><p><strong> </strong><strong>Palabras clave: </strong>Bellucia auxinanthera, Colocasia esculenta, Artocarpus comunis, Cecropia peltata, Pithecellobium sp.</p><p align="center"><strong>BROMATOLOGICAL CHARACTERIZATION OF PLANT RESOURCES FROM COLOMBIAN PACIFIC REGION FOR FISH FOOD</strong></p> Francisco Javier Paredes-Vallejo ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2952 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE TRES PIENSOS COMERCIALES CON DIFERENTES NIVELES DE PROTEINA EN EL CRECIMIENTO Y SOBREVIVENCIA DEL PARGO LUNAREJO Lujtanus guttatus (Steindachner, 1869) http://revistas.udenar.edu.co/index.php/revip/article/view/2954 <p><strong>Introducción</strong> El pargo lunarejo <em>Lutjanus guttatus</em> es una de las especies carnívoras nativas de mayor potencial para la piscicultura marina en el Pacífico colombiano; la cantidad y calidad de la proteína de la dieta es uno de los principales determinantes del crecimiento de la especie. <strong>Metodología</strong> durante 120 días se evaluó el crecimiento de juveniles de pargo lunarejo <em>L. guttatus</em> producidos en laboratorio, para ello se formaron al azar tres tratamientos cada uno con tres réplicas: <em>T1</em>: concentrado comercial con nivel de 40% de proteína (Truchina® 40%); <em>T2</em>: concentrado comercial con nivel de proteína del 45% (Truchina® 45%);  y <em>T3</em>: concentrado comercial con nivel de proteína del 50% (Nicovita® 50%). Se utilizaron tanques de 1500 litros, a densidades de siembra de 30 individuos/m<sup>3</sup>, distribuidos de manera aleatoria en cada tanque y se midieron los parámetros de temperatura y salinidad, la tasa de alimentación diaria fue del 4% de la biomasa corporal, suministrada en dos raciones. Cada 15 días a cada uno de los  peces  se le midió  su longitud estándar (Lt)  y peso total (Wt). El análisis se realizó mediante el Incremento de Peso Diario (IPD), la Tasa de Crecimiento Específico (TCE) y la Sobrevivencia (S). La evaluación del aprovechamiento nutritivo se realizó mediante el Índice de Conversión Alimenticia (ICA). Igualmente se realizó un análisis bromatológico de las tres dietas y del tejido muscular de los peces al inicio y al final en cada uno de los tratamientos. <strong>Resultados. </strong> Los valores de temperatura y salinidad estuvieron en el rango de tolerancia normal de la especie, con 27,3°C (± 1,3) y 27,4 ppm (± 1,6) respectivamente. Se comprobó la existencia de diferencias estadísticas (p&lt;0,05) entre los tratamientos, el IPD  fue mayor en T3, seguidos por T2 y T1 (64,71±7,19 g; 32,09±3.08g y 29,80±2,28g) el mismo comportamiento mostró el ICA. Los índices de supervivencia para los tratamientos fueron relativamente mas altos en T3 con el 80%, seguido en orden por T2 y T1 (64 % y 51 %). En términos generales los peces expuestos al tratamiento T3 mostraron el mejor rendimiento en el crecimiento, aprovechamiento nutritivo y la supervivencia. Los diferentes niveles de proteína de la dieta no influyeron significativamente sobre la composición proteínica del músculo de los peces, el extracto etéreo fue mayor en los músculos de peces en T3. <strong>Conclusión.</strong> Los resultados indican que para un mejor crecimiento y supervivencia., los juveniles de <em>L. guttatus</em> requieren de concentraciones de proteínas de por lo menos el 50%.</p><p><strong> </strong><strong>Palabras claves:</strong> Dietas, sobrevivencia,  proteína, <em>Lutjanus guttatus</em></p><p align="center"><strong>EFFECT OF THREE COMMERCIAL FEED WITH DIFFERENT PROTEIN LEVELS ON GROWTH AND SURVIVAL OF SPOTTED ROSE SNAPPER <em>Lujtanus guttatus</em> (Steindachner, 1869 )</strong></p><p><em><br /></em></p> Jorge Augusto Angulo ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2954 Tue, 06 Dec 2016 20:36:03 -0500 PANORAMA Y PERSPECTIVAS DE LA NUTRICIÓN Y ALIMENTACIÓN DE ESPECIES ÍCTICAS AMAZÓNICAS http://revistas.udenar.edu.co/index.php/revip/article/view/2962 <p><strong>Introducción:</strong> Teniendo en cuenta la importancia cultural y económica de la ictiofauna de la cuenca amazónica, se presenta una revisión de literatura sobre el estado de las investigaciones en nutrición y alimentación de especies de peces nativos de interés comercial de esta región. Teniendo en cuenta que las especies ícticas nativas en Colombia son numerosas y de gran diversidad, ocupando los primeros lugares a nivel mundial (Ramírez<em> et al</em> 2011); se espera que la información presentada contribuya a los futuros desarrollos en ciencia, tecnología e innovación de las especies estudiadas. <strong>Objetivo:</strong> Presentar una revisión sobre el estado de las investigaciones en nutrición y alimentación de las principales especies de peces nativos de interés comercial de la cuenca amazónica colombiana, para identificar los avances y perspectivas de la investigación en áreas temáticas específicas. <strong>Métodos: </strong>A través de una búsqueda en bases de datos se construyó una base de datos con 162 documentos de los últimos 20 años (1996-2016); los cuales fueron analizados siguiendo una metodología propuesta por (Dattakumar y Jagadeesh, 2003). Los documentos relacionados realizaron investigaciones con especies de peces como: Pirarucú <em>Arapaima gigas</em>, cachama negra <em>Colossoma macropomum</em>, cachama blanca <em>Piaractus brachypomus</em>, arawana azul <em>Osteoglossum ferreirai</em>, arawana plateada <em>Osteoglossum bicirrhosum</em>, bocachicos <em>Prochilouds sp</em>, yamú <em>B</em><em>rycon amazonicus</em> y diversidad de bagres. La revisión se realizó desde lo general y no desde lo particular, para poder identificar la dinámica de la investigación en nutrición y alimentación de peces amazónicos. Se identificaron ocho temáticas relacionadas al tema propuesto: Materias primas y digestibilidad, hábitos y comportamiento alimenticio, valoración de dietas y crecimiento, requerimientos nutricionales, fisiología, aditivos, tasa y frecuencia de alimentación y consumo de alimento.  <strong>Resultados: </strong>El análisis de la base de datos mostró que el enfoque de la investigación en nutrición y alimentación de peces amazónicos durante los últimos 20 años ha estado enmarcado desde áreas temáticas como requerimientos nutricionales y valoración de materias primas para alimentación de peces; sobreestimando la investigación en dichos temas, dejando un poco de lado la investigación en la valoración de dietas completas involucrando aspectos técnicos como el análisis de curvas de crecimiento.<strong> Conclusión: </strong>Brasil, Colombia y Perú son los países que más investigan en nutrición y alimentación de peces amazónicos; pero a pesar de existir un aumento porcentual de la investigación en los últimos 20 años, se debe tener en cuenta que en el periodo (2011-2016) la proporción de trabajos enfocados al área de nutrición y alimentación de peces amazónicos creció un 4% con respecto al quinquenio anterior (2006-2010) el cual tuvo un aumento del 16% con respecto al periodo (2001-2005); es por ello que se debe incentivar e iniciar un programa de investigación enfocado en la nutrición y alimentación de peces amazónicos durante los próximos 10 años.</p><p align="left"><strong>Palabras clave: </strong>acuicultura, investigación, bibliografía, datos</p><p align="center"><strong>OVERVIEW AND PROSPECTS FOR FOOD AND NUTRITION OF AMAZONIAN FISH SPECIES</strong></p><p align="center"> </p><p align="left"><strong> </strong></p> Yeferzon A. Ardila-Adame ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2962 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE DIETAS MICROALGALES SOBRE LA SUPERIVENCIA Y PRODUCCIÓN DE NAUPLIOS DEL COPEPODO Parvocalanus crassirostris http://revistas.udenar.edu.co/index.php/revip/article/view/2970 <p><strong>Introducción.</strong> Los copépodos han sido por años catalogados como la mejor presa viva para la mayoría de larvas de peces marinos, prefiriéndolos como alimento vivo frente a las presas convencionales tales como son los rotíferos y <em>Artemia</em>. A pesar de dichos argumentos, el cultivo y aplicación aún están poco desarrollados. En Colombia, se ha implementado en condiciones piloto el cultivo del copépodo <em>Parvocalanus crassirostris</em>, pero aún es necesario refinar, no sólo las condiciones apropiadas para cultivarlo, sino también las estrategias más apropiadas de alimentación, las cuales son dependientes de la especie. Es por lo anterior que la presente investigación se desarrolló con el fin de poder encontrar la dieta más apropiada para dicha especie de copépodo. <strong>Objetivo.</strong> Evaluar tres diferentes dietas microalgales sobre la supervivencia y producción de descendientes por hembra del copépodo <em>Parvocalanus crassirostris. </em><strong>Métodos.</strong> La investigación se desarrolló en dos fases, en las cuales se evaluó la adición diaria de 15 mg de alimento de tres dietas tratamiento realizadas por triplicado: monodieta de <em>Isochrysis galbana</em> (T1),<em> I. </em>galbana mas <em>Tetraselmis suecica</em> (50:50, T2) y una monodieta de <em>T. suecica </em>(T3)<em>.</em>  En la primera fase se determinó la supervivencia de nauplios hasta adultos utilizando las diferentes dietas. Para ello se utilizaron 9 recipientes de vidrio de 3 L, con aireación constante y una densidad inicial de 1 nauplio.ml<sup>-1</sup>. A los seis días se realizó el conteo de los adultos generados para determinar la supervivencia. En la segunda fase se utilizó cajas multiceldas (seis celdas) en las cuales se suministró las respectivas dietas tratamiento, con el fin de alimentar de forma individual hembras fertilizadas (una hembra por celda) que pertenecían a la misma población anterior. Diariamente se realizó el conteo del número de huevos y nauplios producidos para determinar la fecundidad. La temperatura, salinidad y pH fue registrado en el transcurso del experimento. Se realizó análisis de varianza, pruebas de comparación de medias Tukey y la verificación de los supuestos del modelo. <strong>Resultados.</strong> La dieta que generó los mayores valores de supervivencia fue T2 (44,4 ± 5.5%), seguida del T1 y T3 (27,7 ± 5,0% y 16,2 ± 1,06%, respectivamente). Se presentaron diferencias significativas entre los tratamientos (p&lt;0,05), en donde la mayor producción de huevos la presentó T2  (20,5 ± 6,8 huevos.hembra<sup>-1</sup>.día<sup>-1</sup>),  seguido de igual forma por T1 y T3 (9,9 ± 4,25 y 12,2 ± 8,0 huevos.hembra<sup>-1</sup>.día<sup>-1</sup>, respectivamente). <strong>Conclusión. </strong>La dieta que generó la mayor supervivencia y mayor producción de descendientes por hembra fue una combinación de <em>I. galbana </em>con <em>T. suecia</em>. La información anterior contribuye en el mejoramiento de la producción de copépodos, lo cual sin duda incrementará los prospectos de larvicultura y peces marinos. <strong> </strong></p><p><strong> </strong><strong>Palabras clave: </strong>Alimento vivo, microalgas, cultivo, zooplancton</p><p align="center"><strong>EFFECT OF THE MICROALGAE DIETS ON SURVIVAL AND PRODUCTION OF <em>Parvocalanus</em> <em>crassirostris</em> COPEPOD NAUPLII</strong></p> Harold Julián Perez-Gutierrez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2970 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE UN PROBIOTICO, APLICADO EN EL ALIMENTO PARA ALEVINES DE CACHAMA BLANCA (Piaractus brachypomu) http://revistas.udenar.edu.co/index.php/revip/article/view/2972 <p><strong>Introducción</strong>. Los probióticos son microorganismos  adicionados al alimento que permanecen activos en el <a title="Intestino" href="https://es.wikipedia.org/wiki/Intestino">i</a>ntestino y ejercen importantes efectos fisiológicos. Ingeridos en cantidades suficientes, pueden tener efectos beneficiosos, como contribuir al equilibrio de la microbiota intestinal del huésped y potenciar el sistema inmune. <strong>Objetivo</strong>. La inclusión de un probiotico en el alimento para alevines de Cachama blanca (<em>Piaractus brachypomu<strong>)</strong></em>  mejora las variables productivas en la especie. <strong>Métodos</strong>. El estudio se desarrolló en los laboratorios de peces Ornamentales del programa de Ingeniería en Producción Acuícola de la Universidad de Nariño. Los alevines se alimentaron por un periodo de 20 días, tres veces al día, con alimento comercial al 45% de proteína, se realizó la inclusión de probiotico comercial directamente al alimento por medio de una micro pipeta, se realizaron cuatro tratamientos, con diferentes dosis y tres replicas, (sin probiotico, con la dosis recomendada por la  casa comercial del probiotico, con un 50% más  y  un 50% menos de la dosis recomendada por la casa comercial, en un diseño completamente al azar.  <strong>Resultados. </strong>Los animales respondieron bien al suministro del alimento con probiotico, teniendo en cuenta que la supervivencia fue del 100% en todos los tratamientos, sin embargo<strong> </strong>al realizar el análisis de varianza (p&gt;0,05) indicó que no existe  diferencias significativas entre tratamientos  con el   95% confianza, tanto en peso y talla que fueron las variables a evaluar, en sus  periodos iniciales y finales.  <strong>Conclusión. </strong>El probiotico no obtuvo ningún efecto significativo en el incremento de las variables productivas entre los tratamientos, se recomienda revisar los protocolos de inclusión del probiotico en el alimento con el fin de verificar  si existe una  correcta inclusión de este en el alimento.</p><p><strong> </strong><strong>Palabras clave:</strong> microorganismos, efectos fisiológicos, sistema inmune, variables productivas</p><p align="center"><strong>EFFECT OF A PROBIOTIC, APPLIED IN THE FOOD FOR </strong><strong>WHITE CACHAMA FRY   (<em>Piaractus brachypomu)</em></strong></p><p align="center"> </p> Steven Benavides-Rosero ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2972 Tue, 06 Dec 2016 20:36:03 -0500 EFECTO DE UN PROBIÓTICO POSTERIOR A SU INCLUSIÓN EN ALEVINOS DE CACHAMA BLANCA (Piaractus brachypomu) http://revistas.udenar.edu.co/index.php/revip/article/view/2973 <p><strong>Introducción</strong>. La cachama blanca (<em>Piaractus brachypomu</em>) es una de las especies de  gran interés comercial en Colombia debido a la aceptación de su carne. Los costos de producción de esta especie se han incrementado debido al uso de diferentes aditivos en el alimento comercial, buscando mejores resultados en cuanto a las variables productivas<strong>. Objetivo</strong>. El probiotico incluido en el  alimento para alevinos de cachama blanca (<em>Piaractus brachypomu</em>) se mantiene  presente y proporciona incrementos  en las variables productivas de la especie<strong>. Métodos</strong>. El estudio se desarrolló en los laboratorios de peces Ornamentales del programa de Ingeniería en Producción Acuícola de la Universidad de Nariño. Los animales fueron alimentados con un alimento comercial al 45% de proteína durante 20 días utilizando diferentes dosis de probiótico (sin probiotico, con la dosis recomendada por la  casa comercial del probiotico, con un 50% más  y  un 50% menos de la dosis recomendada por la casa comercial) fue agregado al alimento  por el método de micro pipeteo y se suministró inmediatamente , posterior a los 20  días, este fue  suspendió y se realizaron  muestreos de peso y talla cada ocho días durante 20 días,  con el fin de determinar si existe un  aumento significativo en las variables evaluadas después de la suspensión del probiotico. <strong>Resultados</strong>. Posterior a la suspensión del probiotico en el alimento, se obtuvo un supervivencia del 100%, sin embargo el análisis de varianza (p&gt;0,05) indicó que no existe  diferencias significativas con el 95% de confiabilidad  entre las variables evaluadas y los tratamientos. <strong>Conclusiones</strong>. No existe un efecto significativo prolongado en el incremento de las variables productivas entre los tratamientos, en alevinos de cachama  blanca alimentados con una inclusión de probiotico en el alimento, se recomienda estudiar si el probiotico se incorporó adecuadamente en  el alimento y en el  organismo del animal.</p><p><strong> </strong><strong>Palabras clave:</strong> probiótico, alimento comercial, inclusión, variables productivas</p><p align="center"><strong>PROBIOTIC EFFECT OF A POST INCLUSION </strong><strong>EN IN ALEVINES FROM WHITE CACHAMA (<em>Piaractus brachypomu)</em></strong><strong></strong></p> Steven Benavides-Rosero ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2973 Tue, 06 Dec 2016 20:36:03 -0500 CONCENTRACIÓN DE NUTRIENTES EN UN EFLUENTE DEL POLICULTIVO DE TRES ESPECIES ICTICAS COMERCIALES http://revistas.udenar.edu.co/index.php/revip/article/view/2948 <p><strong>Introducción</strong>. La acuicultura es considerada una actividad productiva que genera alimento y aporta a la economía; sin embargo el desarrollo de estas explotaciones genera descargas de nutrientes a las fuentes hídricas o efluentes. Tales nutrientes se derivan de la entrada de material alótocno a los cuerpos de agua o por la sobrecarga del sistema. <strong>Metodología</strong>. Con el objetivo de determinar la concentración de nutrientes y el índice de estado trófico IET de un efluente derivado de una piscícola ubicada en el municipio de Merida- Tolima,  en la cual se implementó un sistema de policultivo intensivo de tilapia roja <em>Oreochomis sp</em>, cachama blanca <em>Piaractus brachypomus</em> y bocachico <em>Prochilosdus sp</em>, con suministro de alimento concentrado (34% PB). Fueron colectadas muestras de agua en la entrada (afluente), en el cultivo y salida (efluente) de la granja,  llevadas al laboratorio de dinámica de nutrientes del Instituto de Acuicultura de los Llanos y posteriormente se analizaron; se determinó la concentración de fosfato, clorofila, amonio y sólidos totales suspendidos. A partir de estos parámetros se estimó el IET, basándose en la ecuación descrita por Carlson (1972). <strong>Resultados</strong>. El IET en el sistema de cultivo y efluente fue de 37 y 40 con un incremento del 3%. En el afluente y efluente todos los parámetros a excepción del fosfato presentaron un incremento, el amonio no ionizado NH<sub>3</sub> de 0,01 y 0,62 mg/L, con un aumento de 0,6 mg/L; sólidos totales suspendidos 70,5 y 92,3 mg/L acrecentamiento de 21.8, fosfato 1,6 y 0,53 mg/L con una disminución de 1,1. El IET tanto en el cultivo como en el efluente fue  menor de &lt;44 lo que representa un medio oligotrófico. La concentración de los sólidos totales y amonio presentaron un incremento, que en caso de los sólidos se relaciona con el trabajo realizado por el bocachico que es un pez detritívoro especializado en remover gran cantidad material orgánico particulado. El aumento del amonio se asocia con la excreción de metabolitos por parte de los organismos cultivados, la descomposición del alimento no consumido, la actividad microbiana y la propia dinámica del sistema. La disminución de los fosfatos se explica por  el aprovechamiento de los organismos fotosintéticos (microalgas) y la interacción con otros compuestos orgánicos. La concentración de estos parámetros muestra que a pesar que el sistema de cultivo está aportando nutrientes al efluente, estos no son lo suficientemente altos para causar alteraciones, puesto que gran parte de ellos  se distribuyen en el sistema de cultivo. <strong>Conclusión</strong>. De acuerdo a los resultados,  los nutrientes estarían siendo recirculados y reutilizados, quedando los productos resultantes disponibles en la columna de agua o sedimentados. La concentración de nutrientes tanto en el sistema de cultivo como en el efluente se puede considerar no perturbadores o tóxicos porque no superan lo reportado en otros trabajos relacionados con esta área.</p><p><strong> </strong><strong>Palabras claves</strong>: Estado trófico, fosfato y amonio</p><p align="center"><strong>NUTRIENT CONCENTRATION IN EFFLUENT POLYCULTURE OF THREE SPECIES COMMERCIAL FISH</strong></p><p align="center"> </p> Diana Camargo ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2948 Tue, 06 Dec 2016 20:36:03 -0500 COMPORTAMIENTO REPRODUCTIVO DE LA ARAWANA (Osteoglossum bicirrhosum) EN CAUTIVERIO EN EL MUNICIPIO DE LEGUÍZAMO http://revistas.udenar.edu.co/index.php/revip/article/view/3017 <p><strong>Introducción. </strong>La piscicultura de consumo y ornamentales en la Amazonia colombiana han venido ganando importancia en la economía local durante los últimos años por causa de la disminución del recurso íctico natural, la sobre pesca, degradación de los ambientes acuáticos y el aumento de los centros poblados de la región. La arawana plateada es una especie ornamental de gran valor y demanda en el mercado nacional e internacional, su cultivo ha ido aumentando en departamentos andino-amazónico como Caquetá y Putumayo adquiriendo gran futuro como sistema productivo intensivo. Actualmente no se cuenta con sistemas de producción de alevinos permanentemente. <strong>Objetivo.</strong> Conocer algunos aspectos reproductivos de la especie manejado en cautiverio en la llanura amazónica del río Putumayo, sector Leguízamo. <strong>Metodología.</strong> La experiencia de manejo con reproductores de arawana, se llevó a cabo en el centro piscícola del municipio de Leguízamo ubicados en el eje fronterizo Colombo-Peruano en los meses de marzo –junio de 2016, se contó con el apoyo del grupo de ecosistemas acuáticos del Instituto Sinchi y estudiante de la Universidad de Nariño. El manejo del lote de reproductores se hizo en dos estanques escavados con un área total de 405 m<sup>2</sup> de espejo de agua y profundidad promedio de 1,3m. Contó con 58 individuos en talla reproductiva y una densidad de cultivo de 12,5 m<sup>2</sup> por animal; La proporción entre machos y hembras no fue posible ser determinada. La alimentación de los padrotes se realizó diariamente calculado con el 1,5% de la biomasa. La alimentación se hizo con filetes de pescado fresco particularmente con bagres pequeños como simí (<em>C. macropterus</em>) y barbiplancho (<em>P. pinirampu</em>). <strong>Resultados.</strong> Se obtuvo reproducción de arawana en estanque dos meses después de la temporada natural. Fueron colectaron 229 individuos entre alevinos y post larvas en el mes mayo provenientes de la cavidad bucal de cuatro machos (57 larvas/macho en promedio), no fue posible identificar las madres. Se observaron diferentes estadios larvales identificados en las etapas I, III, V y VII. <strong>Conclusiones. </strong>El manejo en cautiverio de la arawana plateada en Leguízamo permite la obtención de alevinos por fuera de la temporada de reproducción de la cuenca alta del río Putumayo (Marzo) lo cual genera mejores márgenes de venta en el mercado nacional e internacional. Se observó que la reproducción de los parentales en los estanques no presentó sincronía entre ellos. Debido que no existe dimorfismo sexual en la especie, se recomienda marcaje de los machos durante el periodo reproductivo mediante dispositivos electrónicos como microchips y poder establecer planes de manejo sobre los lotes de reproducción.</p><p><strong>Palabras clave: </strong>piscicultura amazónica, río Putumayo, Osteoglossidae</p><p align="center"><strong>REPRODUCTIVE BEHAVIOR OF ARAWANA (<em>OSTEOGLOSSUM BICIRRHOSUM</em>) IN CAPTIVITY IN THE MUNICIPALITY OF LEGUIZAMO</strong></p> Dora Canchala-Chirán ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/3017 Tue, 06 Dec 2016 20:36:03 -0500 RED EMPRESARIAL COMO ESTRATEGIA ASOCIATIVA ORGANIZACIONAL INNOVADORA PARA PRODUCCION Y COMERCIALIZACION DE TRUCHA DEL ENCANO http://revistas.udenar.edu.co/index.php/revip/article/view/2958 <p>Las debilidades del Sector Acuícola  en El Encano surgen, tanto por la falta de cultura de cooperación por parte de las pequeñas y medianas empresas, como por la ineficiencia del apoyo institucional de organismos públicos o privados; así el problema no es que sean pequeñas sino que están aisladas, y actúan individualmente en una posición débil para competir; situación que diezma su capacidad de acceso a recursos, alcance e impacto del entorno económico y social. <strong>Objetivo.</strong> Diseñar la estructura de la red empresarial como estrategia asociativa organizacional innovadora para fortalecer la producción y comercialización de los piscicultores de trucha del encano. <strong>Métodos.</strong> Se realizó un estudio cuantitativo de tipo descriptivo - comprensivo con enfoque empírico analítico, diagnosticando externamente el sector piscícola a través del análisis de información documental y matrices POAM Y MEFE, e internamente con una encuesta estructurada que se analizó mediante las matrices MPCI, MEFI y FODA, además se analizaron factores de predisposición a la asociatividad. <strong>Resultados</strong>. Entre los principales resultados, se tiene que las pequeñas y medianas empresas del sector piscícola de El Encano, adolecen de competencias necesarias para aprovechar las oportunidades y evitar las amenazas del contexto externo e incursionar en nuevos mercados, lo anterior se evidencia en el análisis interno de las empresas, que demuestra la débil posición estratégica para mejorar las fortalezas y reducir las debilidades en el contexto empresarial, productivo, ambiental y comercial. <strong>Conclusión.</strong> El sector está conformado por PYMEs, que trabajan de manera independiente y desarticulada, demostrando una débil posición estratégica, escasa inversión en tecnología y desarrollo de procesos, dificultad de obtener materia prima a bajo costo, existe poca capacitación técnica para productores, no existen acciones conjuntas adecuadas entre los organismos del Estado y las organizaciones privadas, que promuevan una cultura de exportación en la población. Entre los factores que inciden en la predisposición a la asociatividad empresarial, la mayor desviación la obtuvo conocimiento y tecnología. Entre los principales problemas para asociarse son desconfianza y deslealtad.  El factor compromiso, refiere que pocas personas cumplen con acuerdos y compromisos que exige cualquier asociación, además los piscicultores se muestran reacios en compartir información; más del 67,4% de las piscifactorías entrevistadas estarían dispuestas a asociarse y mejorar tecnología y capacitación para lograr mejores resultados, entrar en nuevos mercados y poder competir en ellos. La mejor alternativa de desarrollo de este sector es asociarse en redes empresariales cuyas ventajas serian: obtener materia prima a bajo costo, mayor poder de negociación con proveedores, incrementar su productividad, lograr un producto de alto valor agregado; así, la red empresarial es más visible ante organizaciones públicas o privadas, para acceder a diferentes políticas, planes, programas y proyectos que le permitan crecer y ser más competitivos.</p><p><strong>Palabras clave: </strong>red horizontal, red vertical, asociatividad, unidad articuladora, piscicultura</p><p class="MsoNormal" style="text-align: center;" align="center"><strong><span style="font-size: 12pt; font-family: 'Times New Roman', serif;" lang="EN-US">BUSINESS NETWORK AS INNOVATIVE STRATEGY ASSOCIATIVE ORGANIZATIONAL FOR PRODUCTION AND MARKETING OF TROUT EL ENCANO</span></strong></p><p class="MsoNormal" style="text-align: justify;"><span style="font-size: 12pt; font-family: 'Times New Roman', serif;" lang="EN-US">horizontal network, vertical network, associativity, articulator unit,</span><span style="font-size: 12pt; font-family: 'Times New Roman', serif;" lang="EN-US">Fish farming</span></p> Alba Lucy Ortega-Salas ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2958 Tue, 06 Dec 2016 20:36:03 -0500 USO DE LA INMUNOHISTOQUÍMICA EN LOS EVENTOS MÓRBIDOS DE PECES http://revistas.udenar.edu.co/index.php/revip/article/view/2977 <p>En la piscicultura, el aumento de la densidad poblacional para obtener mayor producción actúa como elemento estresante y compromete la calidad del agua. Esos factores aumentan la susceptibilidad de los peces a enfermedades infecciosas y parasitarias y facilita la proliferación de agentes con potencial patogénico en el ambiente de producción.  Uno de los procesos fisiopatológicos de gran importancia para mantener la salud del hospedero es la respuesta inflamatoria, cuyos mecanismos son bien conocidos en mamíferos, pero poco claro en otras clases del reino animal. En los peces, este fenómeno también no es bien conocido y merece atención del punto de vista de la fisiopatología comparada, así como por el potencial socioeconómico que representan. Siendo así, el uso de diferentes técnicas de diagnóstico son necesarias para identificar el agente infeccioso y la respuesta del hospedero. La respuesta inflamatoria envuelve varios eventos, como la participación de células teciduales fijas, leucocitos, trombocitos, mediadores farmacológicos celulares y plasmáticos, además de diversos moduladores de origen hormonal y no hormonal. Así, la inmunohistoquímica es una que está surgiendo como una de las diversas herramientas que pueden contribuir para el mejor entendimiento de la respuesta celular y humoral ante un proceso infeccioso.</p><p><strong>Palabras clave:</strong> Anticuerpo, epítopo, histopatología, inmunología, marcador celular, pez</p><p align="center"><strong>IMMUNOHISTOCHEMISTRY USE IN FISH MORBID EVENTS</strong></p> Wilson Gómez-Manrique ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2977 Tue, 06 Dec 2016 20:36:03 -0500 ASPECTOS TÉCNICOS CRUCIALES DE LA TECNOLOGÍA BIOFLOC – TBF, PARA LA PRODUCCIÓN INTENSIVA EN PISCICULTURA http://revistas.udenar.edu.co/index.php/revip/article/view/2978 <p>La piscicultura continental en Colombia, es la actividad de mayor crecimiento del sector agropecuario y del conjunto total de la economía pecuaria nacional (AUNAP), basándose la producción en tres especies: tilapia (Oreochoromis spp), cachama blanca (Piaractus brachypomus) y trucha arco iris (Onchoryncus mikkis), bajo sistemas de producción en jaulas - jaulones, estanques en tierra y piletas en concreto, los cuales tienen como condición común la necesidad de recambios de agua dado la gran cantidad de desechos propios de la actividad los cuales son arrojados al medio sin tratamientos previos.</p><p>Ante la situación planteada, han sido introducidas en el país nuevas tecnologías que permiten aumentar la biomasa de cultivo en un menor volumen de agua y mínimos recambios, siendo la Tecnología Biofloc (TBF) una de las más implementadas, que a diferencia de los sistemas de producción convencionales requiere un mayor conocimiento y comprensión pues es un cultivo de peces en consorcio con microorganismos que requieren relaciones adecuadas de C:N para depurara el agua de los sobrantes producidos.</p><p>En la implementación de la TBF se debe tener en cuenta algunos aspectos que se consideran cruciales y que en este documento se plantean como aporte al desarrollo de una piscicultura alternativa, dichos aspectos están relacionados con el nitrógeno desperdiciado en los alimentos no consumidos y excretado por los peces, las fuentes de carbono suministradas, los requerimientos de oxígeno, la medición continua e interpretación de parámetros de calidad del agua y el personal técnico calificado.</p><p><br /><strong>Palabras clave:</strong> asistencia técnica, calidad de agua, carbono, nitrógeno, oxigeno</p><p>CRUCIAL TECHNICAL ASPECTS OF BIOFLOC TECHNOLOGY - BFT, FOR<br />THE INTENSE PRODUCTION OF FISH FARMING.</p> Luis Felipe Collazos-Lasso ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2978 Tue, 06 Dec 2016 20:36:03 -0500 ESTUDIOS TÉRMICOS PRELIMINARES DE LODOS PRIMARIOS PROVENIENTES DE ACUICULTURA EN RECIRCULACIÓN http://revistas.udenar.edu.co/index.php/revip/article/view/2979 <p>Los sistemas de recirculación para acuicultura han sido utilizados con el fin de disminuir la cantidad de residuos sólidos durante la producción. Sin embargo, son generadas cantidades de lodos tanto primarios como biológicos que deben recibir una adecuada disposición. Los lodos primarios por tener más cantidad de compuestos orgánicos pueden servir como una fuente alternativa de energía. Fueron realizados estudios de termogravimétria (curvas TG e DTG), energía de activación (Ea) y poder calorífico de dos lodos primarios de sistema de recirculación para tilapia nilótica y trucha arcoíris. Los dos lodos presentaron perdida de agua hasta los 150°C y hasta 525°C casi la totalidad de material orgánico fue incinerado dejando únicamente la fracción inorgánica que aparece después de 600°C. Valores de Ea fueron mejores para el lodo primario seco de tilapia (LPSTil) comparado con el lodo primario seco de trucha (LPSTru) siendo<br />aproximadamente el 58% y 64% para los modelos cinéticos de Ozawa-Flynn-Wall (OFW) y Kissinger-Akahira-Sunose (KAS) respectivamente, siendo que LPSTil tiene características mejores para generar calor en caso de ser escogido como fuente alternativa de energía debido a su menor Ea. El poder calorífico de los lodos tanto para LPSTil y LPSTru es de 14,91 MJ/kg y 18,16 MJ/kg, parecido con los valores de biomasas ampliamente utilizadas como los restos de maderas y los lodos de plantas de tratamiento de aguas residuales (PTARs), ambos con posibilidades de uso pero con restricciones para LPSTru por la grande cantidad de energía que se necesitaría para que este material genere calor que pueda ser utilizado inclusive dentro de la misma unidad productiva.</p><p><br /><strong>Palabras Clave:</strong> Ciclo Cerrado, Energía Alternativa, Lodo Bruto, Piscicultura,<br />Combustible</p><p>PRELIMINARY THERMAL STUDIES OF PRIMARY SLUDGES FROM<br />RECIRCULATING AQUACULTURE</p> Yemall Alexander Maigual-Enriquez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2979 Tue, 06 Dec 2016 20:36:03 -0500 AQ-PLUS, BIOTECNOLOGIA UNA ALTERNATIVA A LA PISCICULTURA, ¿Y TU QUE CALIDAD DE AGUA TIENES? http://revistas.udenar.edu.co/index.php/revip/article/view/2980 <p>En la industria Piscícola, mantener la calidad del agua en óptimas condiciones, es vital para lagos, estanques en geomembranas o para la cría de peces en jaulas. El AQ-PLUS ofrece una alternativa no tóxica para el tratamiento de mejora en la calidad del agua y cuando se combina con sistemas de aireación influye para el aumento en la disponibilidad del oxígeno disuelto. El oxígeno y la acción biocatalitica de la materia orgánica atacan directamente la proliferación de enfermedades en los estanques, igualmente proporciona una reducción de los efectos negativos de la piscicultura y al medio ambiente. El AQ-PLUS es una mezcla compleja de sustancias derivadas biológicamente, clasificadas como catalizadores porque aceleran y mejoran la eficiencia de las reacciones químicas y biológicas del medio acuático.<br />El BOC trabaja en conjunto con un rápido desglose bio-catalítico de la materia orgánica dentro del cuerpo de agua, acelera las tasas de bio-remediación de contaminantes al contacto. Demostrado que la composición del BOC (AQ-PLUS) reduce y elimina, amonios, nitritos, (desechos de alimentos-materia orgánica) y algas.<br />El uso del catalizador proporciona la reducción de enfermedades, aumentando la salud general de las poblaciones. Por lo tanto un agua oxigenada y limpia proporciona un ambiente saludable y libre de estrés para los peces.<br />El BOC ha sido probado y se ha demostrado el más alto nivel en seguridad biológica para los organismos acuáticos y la salud de la ecología. El AQ-PLUS es único entre los productos de tratamiento de agua y se ha sometido a pruebas extensas e independientes, que muestra la más alta seguridad para los humanos, animales y vida marina. No es tóxico, no es cáustico, no es corrosivo, no es irritante, hipo alergénico, libre de bacterias, y biodegradable.</p><p><br /><strong>Palabras Claves:</strong> AQ-PLUS, oxigeno, Estrés, biodegradable, piscicultura.</p><p>AQ-PLUS, Biotechnology an alternative to the fish farming,<br />¿And your that you have water quality?</p> Sindy Johana Dias-Andrade ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2980 Tue, 06 Dec 2016 20:36:03 -0500 MICROALGAS NOCIVAS Y SU IMPACTO EN AL ACUICULTURA http://revistas.udenar.edu.co/index.php/revip/article/view/2981 <p>Las Mareas rojas son provocadas por microalgas consideradas dañinas, provocando un fenómeno denominado “Floraciones Algales Nocivas” (FAN). Estas floraciones pueden ser consideras como tóxicas o no tóxicas.<br />Las FAN del tipo No Tóxico, corresponden a floraciones de microalgas que debido a su repentino incremento numérico, afectan la disponibilidad de oxígeno, o dañan a sus branquias de los peces provocando eventos de mortalidad, proceso que es muy letal para los peces que se encuentran en jaulas marinas, como es el caso del cultivo de Salmon en Chile, durante el mes de febrero del presente año, se presentó una perdida de más de 38 mil toneladas. Las Algas nocivas también pueden provocar mortalidad a los cultivos de moluscos filtradores, ya que pueden matar a toda una cohorte ya sea a nivel larval, juvenil o tallas comercial. Estos eventos de Algas nocivas provocan grandes perdidas económicas a las industrias y lamentablemente solo se pueden hacer acciones de mitigación para disminuir el impacto, ya que siempre se presentarán perdidas. Las FAN del tipo Tóxico corresponden a floraciones de microalgas que en su metabolismo generan sustancias altamente tóxicas para la salud humana, conocidas como biotoxinas marinas. Los moluscos filtradores que se alimentan de microalgas concentran estas toxinas en sus tejidos, convirtiéndolos en alimentos altamente tóxicos, que pueden provocar la<br />muerte de quienes los consuman. Estas toxinas marinas se pueden clasificar según sus efectos o signos clínicos en el ser humano: como el Veneno Paralizante de los Mariscos (VPM), Veneno Diarreico de los Mariscos (VDM),Veneno Amnésico de los Mariscos (VAM). Cuando se presentan estos venenos se cierran las zonas de cultivo, y algunas veces estos cierres cautelares duran meses, provocando el cierre o la quiebra de la empresa<br />cultivadora.</p> Eduardo Gastón Uribe-Tapia ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2981 Tue, 06 Dec 2016 20:36:03 -0500 POTENCIALIDAD DE LAS MICROALGAS COMO ALIMENTO Y BIOMEDICINA http://revistas.udenar.edu.co/index.php/revip/article/view/2982 <p>Las microalgas son organismos unicelulares ampliamente conocidas, especialmente por la biotecnológica, por sus potenciales aplicaciones en la industria energética, alimentaria y farmacéutica. El número de táxones es elevado, se cuentan hasta ahora más de 30.000 especies de microalgas sobrepasando las 10.000 especies de cianofíceas y clorofíceas, representando en la actualidad un recurso prácticamente inexplorado, ya que solamente unas 50 especies han sido estudiadas con detalle desde el punto de vista fisiológico y bioquímico. Estas microalgas son <strong>ricas en vitaminas, ácidos grasos, aminoácidos esenciales y</strong> <strong>polisacáridos</strong>, propiedades que las hace excelentes como ingredientes activos para alimentos que puedan reforzar las carencias nutricionales de la población que registran déficits en defensas. La poblaciones precolombinas que habitaron la actual ciudad de México y como las que viven en el Lago Chad – Africa, se han alimentado de Spirulina y también las poblaciones Andinas de Perú-Bolivia-Chile consumen otra especie de cianofita como el Nostoc. Los recientes estudios muestran que Las cianophytas y chlorophytas, han mostrado nuevas propiedades de alimentos saludables orientados a estimular el sistema inmunológico. Las preparaciones de polisacáridos de alto peso molecular, aislados de microalgas de grado alimenticio, han sido descritas como potentes activadoras de macrófagos monocitos humanos (i.e., “Immulina” de <em>Spirulina platensis </em>,“Immunon” de <em>Aphanizomenon flos-aquae </em>e “Immurella” de <em>Chlorella pyrenoidosa </em>; Pugh et al. 2001). Cada uno de estos polisacáridos incrementa sustancialmente los niveles del mRNA de IL-1β y TNF-α y son entre cien y mil veces más activos para la activación <em>in vitro </em>de monocitos que las preparaciones de polisacáridos que son utilizados clínicamente en la actualidad para la inmunoterapia del cáncer (Abdala-Díaz et.al, 2010). También están las microalgas productoras de pigmentos antioxidantes beneficiosos para la salud humana como las micosporinas y astaxantinas. En estos últimos años se destaca la Biotecnología Azul, también llamada <strong>Biotecnología</strong> <strong>marina</strong>, que describe las aplicaciones de la biotecnología en ambientes marinos y acuáticos, donde se destaca la <strong>algología, </strong>que esta procurando mejorar las especies y conseguir <strong>nuevos</strong> <strong>ingredientes </strong>alimentarios, cosméticos, desarrollo de <strong>medicamentos</strong>, <strong>biorremediación </strong>y <strong>biocombustibles.</strong></p> Eduardo Gastón Uribe-Tapia ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2982 Tue, 06 Dec 2016 20:36:03 -0500 DAÑOS EN EL ESPERMATOZOIDE DURANTE EL PROCESO DE CRIOCONSERVACIÓN http://revistas.udenar.edu.co/index.php/revip/article/view/2983 <p>La crioconservación de semen es una herramienta para mejorar la producción de alevinos, atendiendo la demanda de semen y simplificando la reproducción en cautiverio; sin embargo, la crioconservación ocasiona daños a las células espermáticas por el estrés tóxico y osmótico ocasionado por la exposición a los crioprotectores y por los choques térmicos que sufre durante la congelación y descongelación. La magnitud de los daños criogénicos, en el proceso de crioconservación puede resultar en la disminución de la movilidad, velocidad espermática y capacidad fertilizante del semen crioconservado; por lo que el objetivo de esta conferencia es discutir los principales daños que sufre la célula espermática durante el proceso de crioconservación-descongelación, así como referenciar algunos de los métodos de evaluación de los daños que sufre la célula espermática durante la dilución (precongelación), congelación y descongelación.</p> Víctor J. Atencio-García ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2983 Tue, 06 Dec 2016 20:36:03 -0500 PRODUCCIÓN SOSTENIBLE DE ALIMENTOS MEDIANTE SISTEMAS DE AGROACUICULTURA INTEGRADA http://revistas.udenar.edu.co/index.php/revip/article/view/2984 <p>El crecimiento de la población mundial ha generado un incremento en la demanda de alimentos, ocasionando principalmente serios problemas en la disponibilidad de agua y de espacios para cultivo. En este sentido, el principal limitante para la producción de alimentos y la lucha contra la inseguridad alimentaria es el uso eficiente del agua. Se conoce que el Sistema de Agro Acuicultura Integrada (SAAI) es una alternativa para el futuro de la producción sostenible de alimentos, basado en conexiones y sinergias entre distintas actividades internas y externas a los Acuicultores de Recursos Limitados (AREL) o pequeños productores agrícolas y pecuarios. El SAAI es más eficiente en el uso de los recursos naturales como el agua, incluyendo también amplios beneficios en aspectos sociales y económicos, sin los efectos negativos derivados del abuso de insumos externos y del medio ambiente. Este documento presenta inicialmente una revisión del Sistema Agro Acuicultura Integrada y su potencial para incrementar la producción de alimentos y reducir los efectos de la escasez de agua, realizando un acercamiento a los diferentes niveles de integración de la acuicultura con especies como aves de corral y cerdos, así como con cultivos como arroz o huertas familiares. Finalmente, se presentan resultados de estudios y experimentos en los que se ha comparado la efectividad y pertinencia ambiental, social y económica de la Agro Acuicultura Integrada comparada con la acuicultura intensiva en diferentes poblaciones del mundo. </p><p><strong>Palabras claves: </strong>estanque, huerta, peces, sinergia, sub-sistema.</p><p>SUSTAINABLE FOOD PRODUCTION BY INTEGRATED AQUACULTUREAGRICULTURE<br />SYSTEMS</p> Adriana P. Muñoz-Ramírez ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2984 Tue, 06 Dec 2016 20:36:03 -0500 EVALUACIÓN POR ENSAYOS SEMI-ESTÁTICOS DE TOXICIDAD AGUDA DEL NH3 EN ALEVINOS DE TILAPIA http://revistas.udenar.edu.co/index.php/revip/article/view/2985 <p>Las excesivas concentraciones de amoníaco no ionizado (NH3) en sistemas de producción intensiva o en sistemas de piscicultura abastecidos con aguas residuales pueden comprometer la sobrevivencia o ganancia de peso de los peces. El principal objetivo de este estudio fue evaluar la toxicidad aguda del NH3 en alevinos de tilapia GIFT. Se ejecutaron dos experimentos de 96 horas con alevinos con pesos medios de 19,1 ± 5,09 g (primer ensayo) y 6,54 ± 1,94 g (segundo ensayo) en acuarios de 20 litros de volumen efectivo; se determinaron seis tratamientos: T0–control – 0,0; T1– 0,5, T2- 0,89, T3-1,58, T4-2,81, T5-5,0 mg/L de N-NH3 con cuatro repeticiones en sistemas de recirculación acuícola. Un alevino murió en el T5 en el primer ensayo, y murieron 16 alevinos en el durante el segundo ensayo, lo que indicó la resistencia de la especie evaluada a concentraciones de hasta 5 mg/L de amoníaco no ionizado, con mayor sensibilidad en peces con menor peso.</p><p>SEMI-ESTATIC TESTS FOR ACUTE TOXICITY OF NH3 EVALUATION ON<br />TILAPIA FINGERLINGS</p> Iván Andrés Sánchez Ortiz ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2985 Tue, 06 Dec 2016 20:36:03 -0500 USO DE EFLUENTES DOMÉSTICOS Y EXCRETAS EN PISCICULTURA: POTENCIAL, LIMITACIONES Y DESAFÍOS http://revistas.udenar.edu.co/index.php/revip/article/view/2986 <p><strong>1. INEQUIDAD, POBREZA Y FALTA DE ALIMENTO</strong></p><p>La inequidad en el mundo es un problema persistente que se manifiesta en diferentes formas dentro de las sociedades. A finales de la década pasada, la quinta parte de la población mundial disfrutó de más del 70% de los ingresos, mientras que otra parte semejante únicamente accedió al 2% de los mismos. Al finalizar el período de seguimiento de las metas establecidas en los Objetivos de Desarrollo del Milenio –ODM-, se observó que en las regiones en desarrollo en su conjunto, la proporción de personas subalimentadas en la población total disminuyó del 23,3% en 1990-92 al 12,9% en 2015; sin embargo, para ese mismo año se estimó que hubo unos 795 millones de personas subalimentadas en el mundo. Según la FAO, en el decenio 2005-2014, la producción piscícola creció un 5,8% anual; adicionalmente afirmó que la acuicultura continental de peces de escama, el tipo de operación acuícola más habitual en el mundo, supuso el 65% del incremento de la producción pesquera en el período 2005-2014, y que el cultivo continental de peces en estanques de tierra es, con mucho, la práctica acuícola que más contribuye a la seguridad alimentaria y la nutrición en los países en desarrollo.</p><p><strong>2. PANORAMA DEL AGUA POTABLE Y EL SANEAMIENTO</strong></p><p>De acuerdo con OMS y UNICEF, en 2010 se logró la meta de uno de los ODM, en el sentido de garantizar que 88% de la población mundial tuviese acceso a agua potable, la tendencia continuó y para 2015 el porcentaje ascendió hasta un 91%; sin embargo, el panorama para el saneamiento no fue igualmente favorable, pues se aspiraba a que el 77% de la población accediera a condiciones de saneamiento mejorado, pero únicamente se logró llegar al 68%.</p><p><strong>2.1 Tratamiento de aguas residuales</strong></p><p>Las aguas residuales (AR) urbanas son una combinación de efluentes domésticos  industriales, de establecimientos comerciales e institucionales, agua lluvia y drenaje urbano. Dependiendo del(los) tipo(s) de contaminante(s) que se pretende remover de las AR es necesario aplicar uno o varios de los niveles de tratamiento disponibles: preliminar, primario, secundario y terciario o avanzado para lo cual existe una enorme gama de opciones tecnológicas, algunas de ellas extremamente eficientes y sofisticadas pero muy costosas.</p><p><strong>2.2 Tecnologías para regiones en vías de desarrollo</strong></p><p>Las tecnologías naturales para tratamiento de AR se definen como aquellas que emplean procesos naturales (biológicos, físicos y/o químicos); alcanzan niveles de tratamiento aceptables; requieren de bajo capital de inversión; presentan bajos costos de operación y mantenimiento; y requieren de operadores menos cualificados. Los sistemas de tratamiento que se enmarcan en este tipo de tecnologías son las lagunas de estabilización (LE), los humedales construidos (<em>wetlands</em>) y el tratamiento por disposición en el suelo.</p><p><strong>2.3 Lagunas de estabilización</strong></p><p>Las LE son sistemas de tratamiento relativamente simples de construir y operar, capaces de asimilar grandes variaciones en el caudal de AR, que pueden proporcionar eficiencias de tratamiento similares a las producidas por sistemas convencionales (generando un efluente altamente purificado) con costos muy inferiores. El tratamiento de la materia orgánica de las AR en LE es principalmente el resultado de: sedimentación del material en suspensión y formación de una capa de lodo donde ocurren procesos anaerobios; una asociación de mutualismo entre bacterias y algas, donde la oxidación de la materia orgánica se logra por medio de las bacterias en la presencia de oxígeno disuelto suministrado por la fotosíntesis algal.</p><p><strong>3. REÚSO DEL AGUA</strong></p><p>En comunidades con limitada disponibilidad de fuentes de agua, la recuperación y el reúso del agua en diversas actividades son opciones atractivas para conservar y ampliar las fuentes del líquido.</p><p><strong>3.1 Uso de excretas y aguas residuales en piscicultura</strong></p><p>Existen tres tipos de reúso directo de AR en piscicultura: fertilización de los estanques con efluentes tratados; fertilización de los tanques con excretas o lodos sanitarios; cultivo de peces directamente en LE. La tolerancia de la tilapia a pobres condiciones de calidad del agua, y al consumo de una amplia variedad de alimento natural hacen de ella la especie con mayor potencial para desarrollo de piscicultura en efluentes sanitarios tratados. El diseño del sistema integrado de tratamiento-piscicultura se basa en el criterio del mínimo nivel de tratamiento del AR en LE para la máxima producción microbiológicamente segura de peces, y considera el decaimiento de las bacterias entéricas y virus en los tanques fertilizados para peces, que funcionan de manera similar a las lagunas de maduración. Para realizar el tratamiento de efluentes domésticos y la producción de peces la OMS (WHO, 2006) recomienda la implantación de una laguna anaerobia, una laguna facultativa y tanques de cultivo con TRH respectivos del orden de 1, 5, y 92 días y el dimensionamiento de los estanques para una carga superficial de 4 kg/ha.d de N total. Se han realizado estudios para evaluar el cultivo de alevinos de tilapia en efluentes de lagunas de maduración en Brasil con diferentes densidades de siembra y tasas de renovación del agua. La literatura también reporta trabajos enfocados al uso de efluentes domésticos tratados en LE para producción de carne de tilapia, las principales experiencias fueron realizadas en Tailandia y en Perú.</p><p><strong>4. LIMITACIONES</strong></p><p><strong>4.1 Falta de difusión de la validez y seguridad del método.</strong></p><p>La OMS (WHO, 2006) compiló el estado del arte relacionado con los riesgos por uso de excretas y AR en acuacultura, así como estudios epidemiológicos y aspectos sobre análisis de riesgo microbiológico cuantitativo (ACRM) para los grupos expuestos: trabajadores, comunidades locales y consumidores. La OMS definió también niveles de protección de la salud para cada tipo de riesgo; los objetivos de salud pueden determinarse con base en medidas estandarizadas de enfermedad, como los DALY (<em>Disability Adjusted Life Years</em>), suma de Años Potenciales de Vida Perdidos más Años Vividos con Discapacidad.</p><p>Existe poca difusión de la metodología donde los objetivos de salud se estructuran a partir de:</p><ul><li>· Niveles de riesgo tolerable</li><li>· Características del AR o las excretas</li><li>· Escenario de exposición al AR (tiempo y tipo de exposición)</li><li>· Desempeño del sistema de tratamiento de AR</li><li>· Tecnología especificada</li></ul><p><strong>4.2 Falta de aceptación y entendimiento del potencial de uso de las AR tratadas</strong></p><p>Usualmente hay alto rechazo para el uso de AR, la disposición para aceptar el uso de excretas o AR para irrigación o para acuacultura está asociada a núcleos poblacionales densamente poblados, con altos niveles de pobreza y escasas fuentes de empleo, como ocurre en el sur este de Asia, en África y China. Es previsible que exista una aceptación más fácil en regiones con situaciones similares a las antes citadas y donde exista escasez de agua.</p><p><strong>4.3 Urbanización</strong><strong>–</strong><strong>industrialización, contaminantes emergentes</strong></p><p>Existe un creciente nivel de preocupación por la presencia de ciertos contaminantes en las AR urbanas como metales pesados, hormonas, pesticidas y fármacos; proveniente de efluentes industriales o de los propios efluentes domésticos. Su presencia establece riesgos químicos que podrían inviabilizar su uso con fines agrícolas o acuícolas.</p><p><strong>4.4 Desconocimiento y falta de perfeccionamiento de aspectos técnicos:</strong></p><p>Persiste la falta de predictibilidad de la eficiencia de remoción de NH3 en las LE y faltan datos más conclusivos sobre los efectos del amoníaco y su variabilidad diaria en LE y sus efluentes en tanques para piscicultura. No hay datos sobre límites tolerables de tasas de aplicación superficial de amonio, que se traduce en falta de criterios de diseño y operacionales de tanques para piscicultura.</p><p><strong>5. DESAFÍOS </strong><strong>– </strong><strong>OPORTUNIDADES</strong></p><p><strong>5.1 Asociación saneamiento</strong><strong>–</strong><strong>acuicultura con AR</strong></p><p>Dentro de los planes de manejo de las AR se deberían realizar estudios que permitan estimar cuándo las condiciones locales ofrecen potencial de implementar sistemas naturales para tratamiento de AR por LE y asociarlos a piscicultura, considerando que usualmente las LE ocuparán del orden del 10% del área total del proyecto.</p><p><strong>5.2 Evaluación de sistemas en escala real en condiciones ecuatoriales</strong></p><p>Implantar y monitorear sistemas en escala real permitirá ratificar o reformular informaciones técnicas que se asumen como acertadas, que se obtuvieron a partir de experiencias con periodos de evaluación limitados con extrapolación de resultados, a escala reducida, o en países con variaciones climáticas mucho más drásticas que las de países ecuatoriales. Falta incorporar más criterios propios de la acuacultura para optimizar las condiciones de mantenimiento y operación de estanques.</p><p><strong>5.3 Establecimiento de criterios relativos al nitrógeno amoniacal</strong></p><p>Aún se carece de informaciones conclusivas sobre los efectos agudos y crónicos por toxicidad del amoníaco en sistemas con AR y criterios de diseño relativos a tasas de aplicación de amonio en los tanques de piscicultura.</p><p><strong>Palabras clave. </strong>Acuicultura con aguas residuales, uso de agua residual, riesgo, oportunidades</p><p>DOMESTIC SEWAGE AND EXCRETA USE IN FISH CULTURE:<br />POTENTIAL, LIMITATIONS AND CHALLENGES</p><p> </p> Iván Andrés Sánchez Orti- ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2986 Tue, 06 Dec 2016 20:36:03 -0500 INVESTIGACIONES EN ACUICULTURA MARINA Y CONTINENTAL – AUNAP - 2014 - 2015 http://revistas.udenar.edu.co/index.php/revip/article/view/2987 <p>La AUNAP, desde su creación en el año 2011 y a través de la Oficina de Generación del Conocimiento y la Información ha venido desarrollando investigaciones a partir del año 2013, mediante el establecimiento de alianzas estratégicas con entes vinculados al sector y es así como ha realizado investigaciones con especies nativas marinas y continentales tanto de consumo como ornamentales, así como también con las tilapias y truchas. Se han trabajado aspectos como la adaptación al cautiverio, estudios comportamentales, reproducción, larvicultura, cultivo, genética, nutrición y nuevas tecnologías de producción como es el caso de la Acuaponía y sistemas de Biofloc, entre otros. Cada año hasta la fecha se ha venido avanzado en estos temas, algunos de los cuales demandan mayor tiempo y siempre pretendiendo realizar un aporte al sector de la acuicultura, atendiendo los requerimientos de las regiones, de los gremios, de lo sugerido en la agenda de investigación y en los planes y políticas del país, que sirvan para contribuir al desarrollo de la acuicultura en Colombia.</p><p><strong>Palabras clave: </strong>especies nativas, acuicultura, investigación, alianzas, aunap</p><p>MARINE AQUACULTURE RESEARCH AND CONTINENTAL – AUNAP 2014 –<br />2015</p><p> </p> Gustavo Salazar-Ariza ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2987 Tue, 06 Dec 2016 20:36:03 -0500 PERSPECTIVAS DE LA ACUICULTURA MARINA EN EL CARIBE COLOMBIANO http://revistas.udenar.edu.co/index.php/revip/article/view/2990 <p>El Oceanario Islas del Rosario – Centro de Investigación, Educación y Recreación (CEINER) cuenta con un programa de investigación en acuicultura marina para el desarrollo y adaptación de técnicas de cultivo de especies de interés ecológico y comercial. Con el fin de proteger y recuperar a largo plazo los arrecifes coralinos del Parque Nacional Natural Corales del Rosario y San Bernardo, se instalo y evaluó desde el 2011 dos sistemas de cultivo de corales denominados “guarderías submarinas” (líneas y árboles) a partir de la única colecta inicial de fragmentos del coral cacho de venado <em>Acropora cervicornis </em>coral cuerno de alce <em>Acropora palmata</em>, los cuales se marcaron y se fragmentaron en la medida que crecían para consolidar esta guardería. A partir del 2014 se iniciaron trasplantes masivos de estos fragmentos al medio natural con e fin de recuperar áreas designadas mediante esta tecnica de reproducción asexual. Como complemento de estas labores de restauración coralina, se iniciaron investigaciones para lograr repoblar a futuro corales a partir de la reproducción sexual, con la colecta de gametos en los eventos de reproducción natural con las especies <em>A. cervicornis </em>y <em>Orbicella faveolata </em>que fueron llevados al laboratorio para ser cultivadas. Desde hace mas de 20 años el CEINER –realiza una investigación para lograr la reproducción controlada del Mero Guasa <em>Epinephelus itajara</em>, ya que cuenta con el único plantel de reproductores en condiciones de cautiverio en el mundo. Como un acontecimiento histórico, el mes de mayo de 2015 por primera vez en el mundo se logro con éxito su reproducción a partir de la selección de ejemplares en el CEINER con la cual se desarrollo con éxito su larvicultura y la producción de juveniles. Adicionalmente se cuenta con la tecnica de producción de alevinos y cultivo de la cobia <em>Rachycentron canadum </em>cuya tecnica de engorde en jaulas flotantes ha sido trasferida a algunas organizaciones de pescadores del Caribe colombiano. El pámpano <em>Trachinotus</em> <em>falcatus </em>es otra especie candidata para el desarrollo de su cultivo para lo cual se cuenta con los reproductores adaptados al cautiverio. Son pocas las especies de peces marinos que tienen desarrollo avanzado de investigación en el Caribe colombiano siendo llevadas a cabo con éxito en las instalaciones de CENIACUA y CEINER.</p><p>PROSPECTS IN MARINE AQUACULTURE IN COLOMBIAN CARIBBEAN</p> Jaime Alberto Rojas Ruiz ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2990 Tue, 06 Dec 2016 20:36:03 -0500 Avances y Resultados de la Investigación sobre Cultivo de Silúridos en Colombia http://revistas.udenar.edu.co/index.php/revip/article/view/2992 <p>Los resultados de las investigaciones realizadas con especies de silúridos, más conocidas como bagres, han permitido el desarrollo de una gran industria a nivel mundial, favorecida por el valor comercial y calidad nutricional de su carne, constituyéndose en una alternativa para el desarrollo y diversificación de la piscicultura en muchos países. Estas especies presentan varias ventajas comparativas para su cultivo, tales como adaptación al consumo de alimentos concentrados industriales, rápido crecimiento, altas tasas de conversión alimenticia y tolerancia a un amplio rango de variables físicas y químicas del agua. En Colombia, el mercado de la carne de estas especies es sustentado principalmente por la pesca artesanal y, hasta ahora, ninguna especie ha ingresado sólidamente a los sistemas de cultivo nacionales. En consecuencia, el objetivo es presentar un visión general del estado actual de los avances y resultados de investigación sobre algunos aspectos tecnológicos relacionados con la inducción de la reproducción en cautiverio, los protocolos de larvicultura y alevinaje, así como su comportamiento durante el levante y engorde, con el fin de plantear la viabilidad de ingresar especies endémicas de silúridos como una alternativa para diversificar la industria de la acuicultura Colombiana.</p><p> </p><p><strong>Palabras clave: </strong>acuicultura, alevinaje, bagres, larvicultura, reproducción inducida.</p><p>Progress and Results of Research on Silurids Culture in Colombia</p> Pablo Emilio Cruz-Casallas ##submission.copyrightStatement## http://revistas.udenar.edu.co/index.php/revip/article/view/2992 Tue, 06 Dec 2016 20:36:03 -0500