ESTANDARIZACIÓN DE UNA TÉCNICA DE PCR EN TIEMPO REAL PARA EL DIAGNÓSTICO DE Edwarsiella tarda.

  • Cristian Leandro Cantor
Palabras clave: specificity, sensitivity, strains, gene

Resumen

Introducción: Edwardsiella tarda, es una bacteria Gram negativa perteneciente a la familia de las enterobacterias, aislada a lo largo del mundo en diferentes especies, principalmente acuática. En peces se manifiesta con pequeñas lesiones cutáneas que progresan a abscesos en musculo. Internamente se presenta una congestión generalizada similar a otras septicemias bacterianas. En Colombia ha sido aislada de tilapias (Oreochromis sp.) y actualmente son escasos los medios de diagnóstico molecular para su detección. Objetivo: Estandarizar una técnica de PCR en tiempo real (qPCR) para el diagnóstico de E. tardaMétodos: La estandarización de esta técnica se desarrolló en el laboratorio de biología molecular ASOACUICOLA – Universidad CES en Medellín Colombia. Se realizó el diseño de los primers utilizando el programa Primer3 Input (version 0.4.0)  a partir de la secuencia del gen de la membrana lipoproteica Pcp (pcp), Acceción: AF295331.1 y fueron preliminarmente evaluados por medio de amplificación de PCR in silico (in silico PCR amplification), para determinar su especificidad utilizando cepas bacterianas  ATCC® de Streptococcus agalactiae, S. iniae, Aeromona salmonicida, A. hydrophila, Flavobacterium psycrophilum y Edwarsiella ictaluru, y como control positivo la cepa de E. tarda - ATCC® 15947™. Para estandarizar la PCR convencional se utilizaron los primers: F- 5’CGCGCATAGTATCCTCAACA3´ y R-5’CGAACAGTGCTTAGCCCATT3´ y el kit PCR Master Mix 2X de Thermo Scientific™, modificando las concentraciones en sus diferentes componentes y se realizaron gradientes de temperatura para determinar el perfil térmico. Para la estandarización de la prueba de qPCR, se manejó el perfil térmico establecido con la PCR convencional. Para esta estandarización se utilizaron los reactivos TaqMan Environmental Master Mix 2.0 y el sistema Pathogen Mix, que incluía los primers mencionados más la sonda (FAM™ Probe) (FAM-5´CGTTTCAATAGTGTCATAGCGCCTGC 3´-NFQ). Como control endógeno (control de PCR) se empleó IPC TaqMan Exogenous (VIC™ Probe). Resultados: Se estableció una concentración mínima de sensibilidad de 1:10000 (0.15 fg/ µL) para la PCR convencional, un perfil térmico de la siguiente manera: precalentamiento: 60°C por 30 seg, Desnaturalización: 50°C por 2 min y 95°C por 10 min, 35 ciclos: 95°C por 15 seg, 57°C por 1 min. y alineamiento: 60°C por 30 seg. No se observó amplificación cruzada con otros géneros de bacterias, demostrando así una alta especificidad. Los resultados obtenidos en la qPCR demostraron una buena amplificación, obteniendo una mayor sensibilidad, lográndose detectar concentración de 1:100000 (0.015 fg/ µL). Conclusión: Los primers diseñados a partir del gen de la membrana lipoproteica Pcp (pcp) presentaron una alta especificidad para la detección de E. tarda evitando de esta manera una amplificación cruzada, que junto con la alta sensibilidad obtenida con la estandarización de la qPCRl, contribuyen para la realización de un diagnóstico sensible, confiable y rápido.

Palabras clave: especificidad, sensibilidad, cepas, gen

 

TECHNICAL STANDARDIZATION OF A REAL-TIME PCR FOR DIAGNOSIS OF Edwarsiella tarda.

Descargas

La descarga de datos todavía no está disponible.
Publicado
2016-12-06